miRNA General Information
miRNA Mature ID	hsa-miR-452-5p
miRNA Stemloop AC	MI0001733
miRNA Stemloop ID	hsa-mir-452
Sequence	aacuguuugcagaggaaacuga
TTD Target(s) Regulated by This miRNA	Matrix metalloproteinase-2 (MMP-2)	Successful Target	Target Info	[1]
	Thyroid hormone receptor beta (THRB)	Successful Target	Target Info	[2]
	Dihydropyrimidinase related protein 2 (DPYSL2)	Successful Target	Target Info	[3]
	Polycomb complex protein BMI-1 (BMI1)	Clinical trial Target	Target Info	[4]
	CDK inhibitor 1B p27Kip1 (CDKN1B)	Literature-reported Target	Target Info	[5]
Protein(s) Regulated by This miRNA	Dendritic cell-specific transmembrane protein	Regulated Protein	DCSTP_HUMAN	[1]
	Lymphoid enhancer-binding factor 1	Regulated Protein	LEF1_HUMAN	[4]
	Transcription factor 4	Regulated Protein	ITF2_HUMAN	[4]
References
REF 1	Cigarette smoking decreases global microRNA expression in human alveolar macrophages. PLoS One. 2012;7(8):e44066.
REF 2	Regulatory feedback loop between T3 and microRNAs in renal cancer. Mol Cell Endocrinol. 2014 Mar 25;384(1-2):61-70.
REF 3	Multiple-to-multiple relationships between microRNAs and target genes in gastric cancer. PLoS One. 2013 May 8;8(5):e62589.
REF 4	Downregulation of miR-452 promotes stem-like traits and tumorigenicity of gliomas. Clin Cancer Res. 2013 Jul 1;19(13):3429-38.
REF 5	Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 6	Cigarette smoking decreases global microRNA expression in human alveolar macrophages. PLoS One. 2012;7(8):e44066.
REF 7	Downregulation of miR-452 promotes stem-like traits and tumorigenicity of gliomas. Clin Cancer Res. 2013 Jul 1;19(13):3429-38.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.