miRNA General Information
miRNA Mature ID hsa-miR-452-5p
miRNA Stemloop AC MI0001733
miRNA Stemloop ID hsa-mir-452
Sequence aacuguuugcagaggaaacuga
TTD Target(s) Regulated by This miRNA Matrix metalloproteinase-2 (MMP-2) Successful Target Target Info [1]
Thyroid hormone receptor beta (THRB) Successful Target Target Info [2]
Dihydropyrimidinase related protein 2 (DPYSL2) Successful Target Target Info [3]
Polycomb complex protein BMI-1 (BMI1) Literature-reported Target Target Info [4]
CDK inhibitor 1B p27Kip1 (CDKN1B) Literature-reported Target Target Info [5]
Protein(s) Regulated by This miRNA Dendritic cell-specific transmembrane protein Regulated Protein [1]
Lymphoid enhancer-binding factor 1 Regulated Protein [4]
Transcription factor 4 Regulated Protein [4]
References
REF 1 Cigarette smoking decreases global microRNA expression in human alveolar macrophages. PLoS One. 2012;7(8):e44066.
REF 2 Regulatory feedback loop between T3 and microRNAs in renal cancer. Mol Cell Endocrinol. 2014 Mar 25;384(1-2):61-70.
REF 3 Multiple-to-multiple relationships between microRNAs and target genes in gastric cancer. PLoS One. 2013 May 8;8(5):e62589.
REF 4 Downregulation of miR-452 promotes stem-like traits and tumorigenicity of gliomas. Clin Cancer Res. 2013 Jul 1;19(13):3429-38.
REF 5 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 6 Cigarette smoking decreases global microRNA expression in human alveolar macrophages. PLoS One. 2012;7(8):e44066.
REF 7 Downregulation of miR-452 promotes stem-like traits and tumorigenicity of gliomas. Clin Cancer Res. 2013 Jul 1;19(13):3429-38.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.