miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-454-3p | ||||
| miRNA Stemloop AC | MI0003820 | ||||
| miRNA Stemloop ID | hsa-mir-454 | ||||
| Sequence | uagugcaauauugcuuauagggu | ||||
| TTD Target(s) Regulated by This miRNA | Stromal cell-derived factor 1 (CXCL12) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Mothers against decapentaplegic homolog 4 | Regulated Protein | [2] | ||
| Mothers against decapentaplegic homolog 4 | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | MicroRNA-454 regulates stromal cell derived factor-1 in the control of the growth of pancreatic ductal adenocarcinoma. Sci Rep. 2016 Mar 15;6:22793. | ||||
| REF 2 | The oncogenic role of microRNA-130a/301a/454 in human colorectal cancer via targeting Smad4 expression.PLoS One. 2013;8(2):e55532. | ||||
| REF 3 | Expression of microRNA-454 in TGF-1-stimulated hepatic stellate cells and in mouse livers infected with Schistosoma japonicum.Parasit Vectors. 2014 Mar 31;7:148. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.