miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-455-5p | ||||
| miRNA Stemloop AC | MI0003513 | ||||
| miRNA Stemloop ID | hsa-mir-455 | ||||
| Sequence | uaugugccuuuggacuacaucg | ||||
| TTD Target(s) Regulated by This miRNA | Ribosomal protein S6 kinase beta-1 (S6K1) | Clinical trial Target | Target Info | [1] | |
| Suppressor of cytokine signaling 3 (SOCS3) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Nicastrin | Regulated Protein | [3] | ||
| Ras-related protein Rab-18 | Regulated Protein | [4] | |||
| Ubiquitin-like modifier-activating enzyme 7 | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41. | ||||
| REF 2 | Serum microRNA profiling and bioinformatics analysis of patients with type 2 diabetes mellitus in a Chinese population. Mol Med Rep. 2017 Apr;15(4):2143-2153. | ||||
| REF 3 | MicroRNAs targeting Nicastrin regulate A production and are affected by target site polymorphisms.Front Mol Neurosci. 2014 Jul 18;7:67. | ||||
| REF 4 | MiR-455-5p acts as a novel tumor suppressor in gastric cancer by down-regulating RAB18.Gene. 2016 Nov 5;592(2):308-15. | ||||
| REF 5 | Up-regulation of miR-455-5p by the TGF--SMAD signalling axis promotes the proliferation of oral squamous cancer cells by targeting UBE2B.J Pathol. 2016 Sep;240(1):38-49. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.