miRNA General Information
miRNA Mature ID	hsa-miR-4717-5p
miRNA Stemloop AC	MI0017352
miRNA Stemloop ID	hsa-mir-4717
Sequence	uaggccacagccacccaugugu
TTD Target(s) Regulated by This miRNA	G0/G1 switch regulatory protein 8 (RGS2)	Literature-reported Target	Target Info	[1]
References
REF 1	MicroRNA hsa-miR-4717-5p regulates RGS2 and may be a risk factor for anxiety-related traits. Am J Med Genet B Neuropsychiatr Genet. 2015 Jun;168B(4):296-306.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.