miRNA General Information
miRNA Mature ID	hsa-miR-4723-5p
miRNA Stemloop AC	MI0017359
miRNA Stemloop ID	hsa-mir-4723
Sequence	ugggggagccaugagauaagagca
TTD Target(s) Regulated by This miRNA	Tyrosine-protein kinase ABL1 (ABL)	Successful Target	Target Info	[1]
References
REF 1	Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.