miRNA General Information
miRNA Mature ID	hsa-miR-483-5p
miRNA Stemloop AC	MI0002467
miRNA Stemloop ID	hsa-mir-483
Sequence	aagacgggaggaaagaagggag
TTD Target(s) Regulated by This miRNA	Extracellular signal-regulated kinase 1 (ERK1)	Clinical trial Target	Target Info	[1]
	Notch-3 receptor (NOTCH3)	Clinical trial Target	Target Info	[2]
	Transforming protein RhoA (RHOA)	Discontinued Target	Target Info	[3]
	Activated leukocyte cell adhesionmolecule (ALCAM)	Clinical trial Target	Target Info	[4]
Protein(s) Regulated by This miRNA	Creatine kinase B-type	Regulated Protein	KCRB_HUMAN	[5]
	Protein FAM160B2	Regulated Protein	F16B2_HUMAN	[6]
	Serum response factor	Regulated Protein	SRF_HUMAN	[7]
References
REF 1	MiR-483-5p suppresses the proliferation of glioma cells via directly targeting ERK1. FEBS Lett. 2012 May 7;586(9):1312-7.
REF 2	Characterization of microRNA profile in human cumulus granulosa cells: Identification of microRNAs that regulate Notch signaling and are associated with PCOS. Mol Cell Endocrinol. 2015 Mar 15;404:26-36.
REF 3	miR-125a-3p and miR-483-5p promote adipogenesis via suppressing the RhoA/ROCK1/ERK1/2 pathway in multiple symmetric lipomatosis. Sci Rep. 2015 Jul 7;5:11909.
REF 4	miR-483-5p promotes invasion and metastasis of lung adenocarcinoma by targeting RhoGDI1 and ALCAM. Cancer Res. 2014 Jun 1;74(11):3031-42.
REF 5	Extracellular metabolic energetics can promote cancer progression.Cell. 2015 Jan 29;160(3):393-406.
REF 6	Retinoic acid induced 16 enhances tumorigenesis and serves as a novel tumor marker for hepatocellular carcinoma.Carcinogenesis. 2012 Dec;33(12):2578-85.
REF 7	MiR-483-5p controls angiogenesis in vitro and targets serum response factor.FEBS Lett. 2011 Oct 3;585(19):3095-100.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.