miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-487b-5p | ||||
| miRNA Stemloop AC | MI0003530 | ||||
| miRNA Stemloop ID | hsa-mir-487b | ||||
| Sequence | gugguuaucccuguccuguucg | ||||
| TTD Target(s) Regulated by This miRNA | Prominin-1 (PROM1) | Clinical trial Target | Target Info | [1] | |
| Nestin (NES) | Literature-reported Target | Target Info | [1] | ||
| References | |||||
| REF 1 | MicroRNA profiling of low-grade glial and glioneuronal tumors shows an independent role for cluster 14q32.31 member miR-487b. Mod Pathol. 2017 Feb;30(2):204-216. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.