miRNA General Information
miRNA Mature ID	hsa-miR-491-3p
miRNA Stemloop AC	MI0003126
miRNA Stemloop ID	hsa-mir-491
Sequence	cuuaugcaagauucccuucuac
TTD Target(s) Regulated by This miRNA	Cyclin-dependent kinase 6 (CDK6)	Successful Target	Target Info	[1]
	Multidrug resistance protein 1 (ABCB1)	Clinical trial Target	Target Info	[2]
	Insulin-like growth factor-binding protein 2 (IGFBP2)	Literature-reported Target	Target Info	[3]
References
REF 1	Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 2	Atorvastatin attenuation of ABCB1 expression is mediated by microRNA miR-491-3p in Caco-2 cells. Eur J Pharm Sci. 2016 Oct 10;93:431-6.
REF 3	Two mature products of MIR-491 coordinate to suppress key cancer hallmarks in glioblastoma. Oncogene. 2015 Mar 26;34(13):1619-1628.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.