miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-495-3p | ||||
| miRNA Stemloop AC | MI0003135 | ||||
| miRNA Stemloop ID | hsa-mir-495 | ||||
| Sequence | aaacaaacauggugcacuucuu | ||||
| TTD Target(s) Regulated by This miRNA | Multidrug resistance protein 1 (ABCB1) | Clinical trial Target | Target Info | [1] | |
| RAC-alpha serine/threonine-protein kinase (AKT1) | Successful Target | Target Info | [2] | ||
| Endoplasmic reticulum chaperone BiP (HSPA5) | Clinical trial Target | Target Info | [3] | ||
| Monocyte chemotactic and activating factor (CCL2) | Clinical trial Target | Target Info | [4] | ||
| Protein tyrosine phosphatase IVA 3 (PRL-3) | Literature-reported Target | Target Info | [5] | ||
| Polycomb complex protein BMI-1 (BMI1) | Clinical trial Target | Target Info | [6] | ||
| Runt-related transcription factor 3 (RUNX3) | Literature-reported Target | Target Info | [7] | ||
| Forkhead box protein C1 (FOXC1) | Literature-reported Target | Target Info | [8] | ||
| High mobility group protein HMGI-C (HMGA2) | Literature-reported Target | Target Info | [9] | ||
| Protein(s) Regulated by This miRNA | Copper-transporting ATPase 1 | Regulated Protein | [10] | ||
| Homeobox protein Meis1 | Regulated Protein | [11] | |||
| Metastasis-associated protein MTA3 | Regulated Protein | [12] | |||
| Pre-B-cell leukemia transcription factor 3 | Regulated Protein | [11] | |||
| S-adenosylmethionine synthase isoform type-1 | Regulated Protein | [13] | |||
| Submaxillary gland androgen-regulated protein 3B | Regulated Protein | [14] | |||
| TBC1 domain family member 9 | Regulated Protein | [15] | |||
| Transcription factor SOX-9 | Regulated Protein | [16] | |||
| References | |||||
| REF 1 | miR-495 sensitizes MDR cancer cells to the combination of doxorubicin and taxol by inhibiting MDR1 expression. J Cell Mol Med. 2017 Sep;21(9):1929-1943. | ||||
| REF 2 | MiR-495 inhibits esophageal squamous cell carcinoma progression by targeting Akt1. Oncotarget. 2016 Aug 9;7(32):51223-51236. | ||||
| REF 3 | miR-199a-5p and miR-495 target GRP78 within UPR pathway of lung cancer. Gene. 2017 Jul 15;620:15-22. | ||||
| REF 4 | MicroRNA-495 regulates the proliferation and apoptosis of human umbilical vein endothelial cells by targeting chemokine CCL2. Thromb Res. 2015 Jan;135(1):146-54. | ||||
| REF 5 | miR-495 and miR-551a inhibit the migration and invasion of human gastric cancer cells by directly interacting with PRL-3. Cancer Lett. 2012 Oct 1;323(1):41-7. | ||||
| REF 6 | MicroRNAs in the imprinted DLK1-DIO3 region repress the epithelial-to-mesenchymal transition by targeting the TWIST1 protein signaling network. J Biol Chem. 2012 Dec 14;287(51):42695-707. | ||||
| REF 7 | Targeting of RUNX3 by miR-130a and miR-495 cooperatively increases cell proliferation and tumor angiogenesis in gastric cancer cells. Oncotarget. 2015 Oct 20;6(32):33269-78. | ||||
| REF 8 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 9 | MicroRNA-495 Inhibits Gastric Cancer Cell Migration and Invasion Possibly via Targeting High Mobility Group AT-Hook 2 (HMGA2). Med Sci Monit. 2017 Feb 4;23:640-648. | ||||
| REF 10 | miR-495 enhances the sensitivity of non-small cell lung cancer cells to platinum by modulation of copper-transporting P-type adenosine triphosphatase A (ATP7A).J Cell Biochem. 2014 Jul;115(7):1234-42. | ||||
| REF 11 | MiR-495 is a tumor-suppressor microRNA down-regulated in MLL-rearranged leukemia.Proc Natl Acad Sci U S A. 2012 Nov 20;109(47):19397-402. | ||||
| REF 12 | MiR-495 regulates proliferation and migration in NSCLC by targeting MTA3.Tumour Biol. 2014 Apr;35(4):3487-94. | ||||
| REF 13 | MicroRNAs regulate methionine adenosyltransferase 1A expression in hepatocellular carcinoma.J Clin Invest. 2013 Jan;123(1):285-98. | ||||
| REF 14 | Methylation-associated silencing of miR-495 inhibit the migration and invasion of human gastric cancer cells by directly targeting PRL-3.Biochem Biophys Res Commun. 2015 Jan 2;456(1):344-50. | ||||
| REF 15 | Changes in the expression of miR-381 and miR-495 are inversely associated with the expression of the MDR1 gene and development of multi-drug resistance.PLoS One. 2013 Nov 26;8(11):e82062. | ||||
| REF 16 | microRNA-495 inhibits chondrogenic differentiation in human mesenchymal stem cells by targeting Sox9.Stem Cells Dev. 2014 Aug 1;23(15):1798-808. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.