miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-499a-5p | ||||
| miRNA Stemloop AC | MI0003183 | ||||
| miRNA Stemloop ID | hsa-mir-499a | ||||
| Sequence | uuaagacuugcagugauguuu | ||||
| TTD Target(s) Regulated by This miRNA | Protein C-ets-1 (ETS1) | Literature-reported Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Forkhead box protein O4 | Regulated Protein | [2] | ||
| Guanine nucleotide exchange factor VAV3 | Regulated Protein | [3] | |||
| Programmed cell death protein 4 | Regulated Protein | [2] | |||
| Transcription factor SOX-6 | Regulated Protein | [4] | |||
| References | |||||
| REF 1 | MicroRNA-1 and microRNA-499 downregulate the expression of the ets1 proto-oncogene in HepG2 cells. Oncol Rep. 2012 Aug;28(2):701-6. | ||||
| REF 2 | MicroRNA-499-5p promotes cellular invasion and tumor metastasis in colorectal cancer by targeting FOXO4 and PDCD4.Carcinogenesis. 2011 Dec;32(12):1798-805. | ||||
| REF 3 | Overexpression of miR-499-5p inhibits non-small cell lung cancer proliferation and metastasis by targeting VAV3.Sci Rep. 2016 Mar 14;6:23100. | ||||
| REF 4 | MicroRNA-1 and -499 regulate differentiation and proliferation in human-derived cardiomyocyte progenitor cells.Arterioscler Thromb Vasc Biol. 2010 Apr;30(4):859-68. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.