miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-508-5p | ||||
| miRNA Stemloop AC | MI0003195 | ||||
| miRNA Stemloop ID | hsa-mir-508 | ||||
| Sequence | uacuccagagggcgucacucaug | ||||
| TTD Target(s) Regulated by This miRNA | Multidrug resistance protein 1 (ABCB1) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | DNA-directed RNA polymerase I subunit RPA12 | Regulated Protein | [1] | ||
| Transmembrane glycoprotein NMB | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | miR-508-5p regulates multidrug resistance of gastric cancer by targeting ABCB1 and ZNRD1. Oncogene. 2014 Jun 19;33(25):3267-76. | ||||
| REF 2 | miR-508-5p regulates multidrug resistance of gastric cancer by targeting ABCB1 and ZNRD1. Oncogene. 2014 Jun 19;33(25):3267-76. | ||||
| REF 3 | MiR-508-5p Inhibits the Progression of Glioma by Targeting Glycoprotein Non-metastatic Melanoma B.Neurochem Res. 2016 Jul;41(7):1684-90. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.