miRNA General Information
miRNA Mature ID	hsa-miR-517c-3p
miRNA Stemloop AC	MI0003174
miRNA Stemloop ID	hsa-mir-517c
Sequence	aucgugcauccuuuuagagugu
TTD Target(s) Regulated by This miRNA	Focal adhesion kinase 2 (PTK2B)	Literature-reported Target	Target Info	[1]
References
REF 1	Down-regulation of miR-517a and miR-517c promotes proliferation of hepatocellular carcinoma cells via targeting Pyk2. Cancer Lett. 2013 Feb 28;329(2):164-73.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.