miRNA General Information
miRNA Mature ID	hsa-miR-518c-3p
miRNA Stemloop AC	MI0003159
miRNA Stemloop ID	hsa-mir-518c
Sequence	caaagcgcuucucuuuagagugu
TTD Target(s) Regulated by This miRNA	Estradiol 17 beta-dehydrogenase 1 (17-beta-HSD1)	Clinical trial Target	Target Info	[1]
	Cellular tumor antigen p53 (TP53)	Clinical trial Target	Target Info	[2]
	Phosphatase and tensin homolog (PTEN)	Literature-reported Target	Target Info	[2]
References
REF 1	Hydroxysteroid (17-) dehydrogenase 1 is dysregulated by miR-210 and miR-518c that are aberrantly expressed in preeclamptic placentas: a novel marker for predicting preeclampsia. Hypertension. 2012 Feb;59(2):265-73.
REF 2	Characterization of dual PTEN and p53-targeting microRNAs identifies microRNA-638/Dnm2 as a two-hit oncogenic locus. Cell Rep. 2014 Aug 7;8(3):714-22.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.