miRNA General Information
miRNA Mature ID hsa-miR-519d-3p
miRNA Stemloop AC MI0003162
miRNA Stemloop ID hsa-mir-519d
Sequence caaagugccucccuuuagagug
TTD Target(s) Regulated by This miRNA Matrix metalloproteinase-2 (MMP-2) Successful Target Target Info [1]
Peroxisome proliferator-activated receptor alpha (PPARA) Successful Target Target Info [2]
Signal transducer and activator of transcription 3 (STAT3) Successful Target Target Info [3]
RAC-gamma serine/threonine-protein kinase (AKT3) Clinical trial Target Target Info [4]
Calcium-release activated calcium channel (CRACM) Clinical trial Target Target Info [5]
E2F transcription factor 1 (E2F1) Clinical trial Target Target Info [6]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [4]
Melanoma differentiation-associated protein 6 (CDKN1A) Literature-reported Target Target Info [4]
Proliferation marker protein Ki-67 (MKI67) Literature-reported Target Target Info [7]
Protein(s) Regulated by This miRNA Metalloproteinase inhibitor 2 Regulated Protein [4]
References
REF 1 MiR-519d-3p suppresses invasion and migration of trophoblast cells via targeting MMP-2. PLoS One. 2015 Mar 24;10(3):e0120321.
REF 2 miR-519d overexpression is associated with human obesity. Obesity (Silver Spring). 2010 Nov;18(11):2170-6.
REF 3 miR-519d-mediated downregulation of STAT3 suppresses breast cancer progression. Oncol Rep. 2015 Oct;34(4):2188-94.
REF 4 In hepatocellular carcinoma miR-519d is up-regulated by p53 and DNA hypomethylation and targets CDKN1A/p21, PTEN, AKT3 and TIMP2. J Pathol. 2012 Jul;227(3):275-85.
REF 5 Orai1, a Direct Target of microRNA-519, Promotes Progression of Colorectal Cancer via Akt/GSK3 Signaling Pathway. Dig Dis Sci. 2016 Jun;61(6):1553-60.
REF 6 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
REF 7 MicroRNA-519d targets MKi67 and suppresses cell growth in the hepatocellular carcinoma cell line QGY-7703. Cancer Lett. 2011 Aug 28;307(2):182-90.
REF 8 In hepatocellular carcinoma miR-519d is up-regulated by p53 and DNA hypomethylation and targets CDKN1A/p21, PTEN, AKT3 and TIMP2. J Pathol. 2012 Jul;227(3):275-85.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.