miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-520a-3p | ||||
| miRNA Stemloop AC | MI0003149 | ||||
| miRNA Stemloop ID | hsa-mir-520a | ||||
| Sequence | aaagugcuucccuuuggacugu | ||||
| TTD Target(s) Regulated by This miRNA | G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [1] | |
| MAPK/ERK kinase kinase 2 (MAP3K2) | Clinical trial Target | Target Info | [2] | ||
| TGF-beta receptor type II (TGFBR2) | Clinical trial Target | Target Info | [3] | ||
| Extracellular matrix receptor III (CD44) | Clinical trial Target | Target Info | [1] | ||
| Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | ATP-dependent 6-phosphofructokinase, platelet type | Regulated Protein | [5] | ||
| Homeobox protein Hox-D8 | Regulated Protein | [6] | |||
| References | |||||
| REF 1 | Suppressing role of miR-520a-3p in breast cancer through CCND1 and CD44. Am J Transl Res. 2017 Jan 15;9(1):146-154. | ||||
| REF 2 | The microRNA-520a-3p inhibits proliferation, apoptosis and metastasis by targeting MAP3K2 in non-small cell lung cancer. Am J Cancer Res. 2015 Jan 15;5(2):802-11. | ||||
| REF 3 | MicroRNA-520c inhibits glioma cell migration and invasion by the suppression of transforming growth factor- receptor type2. Oncol Rep. 2017 Mar;37(3):1691-1697. | ||||
| REF 4 | Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Oncogene. 2010 Apr 15;29(15):2302-8. | ||||
| REF 5 | Tat-activating regulatory DNA-binding protein regulates glycolysis in hepatocellular carcinoma by regulating the platelet isoform of phosphofructokinase through microRNA 520.Hepatology. 2013 Jul;58(1):182-91. | ||||
| REF 6 | microRNA-520a-3p inhibits proliferation and cancer stem cell phenotype by targeting HOXD8 in non-small cell lung cancer.Oncol Rep. 2016 Dec;36(6):3529-3535. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.