miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-520c-3p | ||||
| miRNA Stemloop AC | MI0003158 | ||||
| miRNA Stemloop ID | hsa-mir-520c | ||||
| Sequence | aaagugcuuccuuuuagagggu | ||||
| TTD Target(s) Regulated by This miRNA | Serine/threonine-protein kinase mTOR (mTOR) | Successful Target | Target Info | [1] | |
| Amyloid beta A4 protein (APP) | Successful Target | Target Info | [2] | ||
| Signal transducer and activator of transcription 3 (STAT3) | Successful Target | Target Info | [3] | ||
| NAD-dependent deacetylase sirtuin-1 (SIRT1) | Clinical trial Target | Target Info | [1] | ||
| Extracellular matrix receptor III (CD44) | Clinical trial Target | Target Info | [4] | ||
| Glypican-3 (GPC3) | Clinical trial Target | Target Info | [5] | ||
| Protein(s) Regulated by This miRNA | Eukaryotic translation initiation factor 4 gamma 1 | Regulated Protein | [6] | ||
| Interferon regulatory factor 2 | Regulated Protein | [7] | |||
| MHC class I polypeptide-related sequence A | Regulated Protein | [8] | |||
| References | |||||
| REF 1 | miR-520c and miR-373 upregulate MMP9 expression by targeting mTOR and SIRT1, and activate the Ras/Raf/MEK/Erk signaling pathway and NF-B factor in human fibrosarcoma cells. J Cell Physiol. 2012 Feb;227(2):867-76. | ||||
| REF 2 | MicroRNAs can regulate human APP levels. Mol Neurodegener. 2008 Aug 6;3:10. | ||||
| REF 3 | miR520c blocks EMT progression of human breast cancer cells by repressing STAT3. Oncol Rep. 2017 Mar;37(3):1537-1544. | ||||
| REF 4 | The microRNAs miR-373 and miR-520c promote tumour invasion and metastasis. Nat Cell Biol. 2008 Feb;10(2):202-10. | ||||
| REF 5 | MicroRNA-520c-3p inhibits hepatocellular carcinoma cell proliferation and invasion through induction of cell apoptosis by targeting glypican-3. Hepatol Res. 2014 Mar;44(3):338-48. | ||||
| REF 6 | Down-regulation of eIF4GII by miR-520c-3p represses diffuse large B cell lymphoma development.PLoS Genet. 2014 Jan 30;10(1):e1004105. | ||||
| REF 7 | MicroRNA-520c enhances cell proliferation, migration, and invasion by suppressing IRF2 in gastric cancer.FEBS Open Bio. 2016 Oct 31;6(12):1257-1266. | ||||
| REF 8 | Downregulation of miR-302c and miR-520c by 1,25(OH)2D3 treatment enhances the susceptibility of tumour cells to natural killer cell-mediated cytotoxicity.Br J Cancer. 2013 Aug 6;109(3):723-30. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.