miRNA General Information
miRNA Mature ID	hsa-miR-520d-3p
miRNA Stemloop AC	MI0003164
miRNA Stemloop ID	hsa-mir-520d
Sequence	aaagugcuucucuuuggugggu
TTD Target(s) Regulated by This miRNA	Ephrin type-A receptor 2 (EPHA2)	Clinical trial Target	Target Info	[1]
References
REF 1	Therapeutic synergy between microRNA and siRNA in ovarian cancer treatment. Cancer Discov. 2013 Nov;3(11):1302-15.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.