miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-520g-3p | ||||
| miRNA Stemloop AC | MI0003166 | ||||
| miRNA Stemloop ID | hsa-mir-520g | ||||
| Sequence | acaaagugcuucccuuuagagugu | ||||
| TTD Target(s) Regulated by This miRNA | Matrix metalloproteinase-2 (MMP-2) | Successful Target | Target Info | [1] | |
| Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Death-associated protein kinase 2 | Regulated Protein | [3] | ||
| Transcription elongation factor A protein-like 1 | Regulated Protein | [4] | |||
| References | |||||
| REF 1 | Elevated microRNA-520g in pre-eclampsia inhibits migration and invasion of trophoblasts. Placenta. 2017 Mar;51:70-75. | ||||
| REF 2 | The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719. | ||||
| REF 3 | MicroRNA-520g promotes epithelial ovarian cancer progression and chemoresistance via DAPK2 repression.Oncotarget. 2016 May 3;7(18):26516-34. | ||||
| REF 4 | MicroRNA-520g confers drug resistance by regulating p21 expression in colorectal cancer.J Biol Chem. 2015 Mar 6;290(10):6215-25. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.