miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-520h | ||||
| miRNA Stemloop AC | MI0003175 | ||||
| miRNA Stemloop ID | hsa-mir-520h | ||||
| Sequence | acaaagugcuucccuuuagagu | ||||
| TTD Target(s) Regulated by This miRNA | Histone deacetylase 1 (HDAC1) | Successful Target | Target Info | [1] | |
| ATP-binding cassette transporter G2 (ABCG2) | Successful Target | Target Info | [2] | ||
| Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [3] | ||
| Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | Death-associated protein kinase 2 | Regulated Protein | [5] | ||
| DNA-binding protein inhibitor ID-3 | Regulated Protein | [6] | |||
| References | |||||
| REF 1 | Downregulation of histone deacetylase 1 by microRNA-520h contributes to the chemotherapeutic effect of doxorubicin. FEBS Lett. 2014 Jan 3;588(1):184-91. | ||||
| REF 2 | MicroRNAs play a role in the development of human hematopoietic stem cells. J Cell Biochem. 2008 Jun 1;104(3):805-17. | ||||
| REF 3 | The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719. | ||||
| REF 4 | Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Oncogene. 2010 Apr 15;29(15):2302-8. | ||||
| REF 5 | miR-520h is crucial for DAPK2 regulation and breast cancer progression.Oncogene. 2016 Mar 3;35(9):1134-42. | ||||
| REF 6 | MicroRNA expression profiles in umbilical cord blood cell lineages. Stem Cells Dev. 2010 Jan;19(1):17-26. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.