miRNA General Information
miRNA Mature ID	hsa-miR-539-5p
miRNA Stemloop AC	MI0003514
miRNA Stemloop ID	hsa-mir-539
Sequence	ggagaaauuauccuuggugugu
TTD Target(s) Regulated by This miRNA	Cyclin-dependent kinase 4 (CDK4)	Successful Target	Target Info	[1]
	Matrix metalloproteinase-8 (MMP-8)	Clinical trial Target	Target Info	[2]
Protein(s) Regulated by This miRNA	Caspase recruitment domain-containing protein 11	Regulated Protein	CAR11_HUMAN	[3]
	Sperm-associated antigen 5	Regulated Protein	SPAG5_HUMAN	[4]
	Twist-related protein 1	Regulated Protein	TWST1_HUMAN	[5]
	Zinc finger E-box-binding homeobox 1	Regulated Protein	ZEB1_HUMAN	[5]
References
REF 1	miR-539 induces cell cycle arrest in nasopharyngeal carcinoma by targeting cyclin-dependent kinase 4. Cell Biochem Funct. 2015 Dec;33(8):534-40.
REF 2	MicroRNA-539 suppresses osteosarcoma cell invasion and migration in vitro and targeting Matrix metallopeptidase-8. Int J Clin Exp Pathol. 2015 Jul 1;8(7):8075-82.
REF 3	MiR-539 inhibits thyroid cancer cell migration and invasion by directly targeting CARMA1.Biochem Biophys Res Commun. 2015 Sep 4;464(4):1128-1133.
REF 4	miR-539 inhibits prostate cancer progression by directly targeting SPAG5.J Exp Clin Cancer Res. 2016 Apr 1;35:60.
REF 5	MicroRNAs in the imprinted DLK1-DIO3 region repress the epithelial-to-mesenchymal transition by targeting the TWIST1 protein signaling network. J Biol Chem. 2012 Dec 14;287(51):42695-707.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.