miRNA General Information
miRNA Mature ID	hsa-miR-541-3p
miRNA Stemloop AC	MI0005539
miRNA Stemloop ID	hsa-mir-541
Sequence	uggugggcacagaaucuggacu
TTD Target(s) Regulated by This miRNA	Erbb2 tyrosine kinase receptor (HER2)	Successful Target	Target Info	[1]
	Voltage-gated calcium channel alpha Cav2.3 (CACNA1E)	Literature-reported Target	Target Info	[2]
Protein(s) Regulated by This miRNA	Glucose-6-phosphate exchanger SLC37A1	Regulated Protein	G6PT2_HUMAN	[2]
	Homeobox protein TGIF2	Regulated Protein	TGIF2_HUMAN	[4]
	Protein Hook homolog 3	Regulated Protein	HOOK3_HUMAN	[2]
	Transmembrane protein 178B	Regulated Protein	T178B_HUMAN	[2]
	Tripartite motif-containing protein 67	Regulated Protein	TRI67_HUMAN	[2]
References
REF 1	High-throughput screens identify microRNAs essential for HER2 positive breast cancer cell growth. Mol Oncol. 2014 Feb;8(1):93-104.
REF 2	Identification of Host Micro RNAs That Differentiate HIV-1 and HIV-2 Infection Using Genome Expression Profiling Techniques. Viruses. 2016 May 2;8(5). pii: E121.
REF 3	Identification of Host Micro RNAs That Differentiate HIV-1 and HIV-2 Infection Using Genome Expression Profiling Techniques. Viruses. 2016 May 2;8(5). pii: E121.
REF 4	MiR-541-3p reverses cancer progression by directly targeting TGIF2 in non-small cell lung cancer. Tumour Biol. 2016 Sep;37(9):12685-12695.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.