miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-543 | ||||
| miRNA Stemloop AC | MI0005565 | ||||
| miRNA Stemloop ID | hsa-mir-543 | ||||
| Sequence | aaacauucgcggugcacuucuu | ||||
| TTD Target(s) Regulated by This miRNA | Matrix metalloproteinase-7 (MMP-7) | Successful Target | Target Info | [1] | |
| NAD-dependent deacetylase sirtuin-1 (SIRT1) | Clinical trial Target | Target Info | [2] | ||
| Nitric-oxide synthase endothelial (NOS3) | Clinical trial Target | Target Info | [3] | ||
| Focal adhesion kinase 1 (FAK) | Clinical trial Target | Target Info | [4] | ||
| Metastasis associated gene-1 (MTA1) | Literature-reported Target | Target Info | [5] | ||
| Vitiligo-associated protein 1 (FBXO11) | Literature-reported Target | Target Info | [6] | ||
| High mobility group protein HMGI-C (HMGA2) | Literature-reported Target | Target Info | [7] | ||
| Protein(s) Regulated by This miRNA | Twist-related protein 1 | Regulated Protein | [8] | ||
| Twist-related protein 1 | Regulated Protein | [4] | |||
| References | |||||
| REF 1 | Placental growth factor promotes metastases of ovarian cancer through MiR-543-regulated MMP7. Cell Physiol Biochem. 2015;37(3):1104-12. | ||||
| REF 2 | miR-543 promotes gastric cancer cell proliferation by targeting SIRT1. Biochem Biophys Res Commun. 2016 Jan 1;469(1):15-21. | ||||
| REF 3 | MicroRNA-335 and -543 suppress bone metastasis in prostate cancer via targeting endothelial nitric oxide synthase. Int J Mol Med. 2015 Nov;36(5):1417-25. | ||||
| REF 4 | MicroRNA-543 suppresses endometrial cancer oncogenicity via targeting FAK and TWIST1 expression. Arch Gynecol Obstet. 2014 Sep;290(3):533-41. | ||||
| REF 5 | MicroRNA-543 suppresses colorectal cancer growth and metastasis by targeting KRAS, MTA1 and HMGA2. Oncotarget. 2016 Apr 19;7(16):21825-39. | ||||
| REF 6 | MiRNA-543 promotes osteosarcoma cell proliferation and glycolysis by partially suppressing PRMT9 and stabilizing HIF-1 protein. Oncotarget. 2017 Jan 10;8(2):2342-2355. | ||||
| REF 7 | A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64. | ||||
| REF 8 | MicroRNAs in the imprinted DLK1-DIO3 region repress the epithelial-to-mesenchymal transition by targeting the TWIST1 protein signaling network. J Biol Chem. 2012 Dec 14;287(51):42695-707. | ||||
| REF 9 | MicroRNA-543 suppresses endometrial cancer oncogenicity via targeting FAK and TWIST1 expression. Arch Gynecol Obstet. 2014 Sep;290(3):533-41. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.