miRNA General Information
miRNA Mature ID	hsa-miR-559
miRNA Stemloop AC	MI0003565
miRNA Stemloop ID	hsa-mir-559
Sequence	uaaaguaaauaugcaccaaaa
TTD Target(s) Regulated by This miRNA	Erbb2 tyrosine kinase receptor (HER2)	Successful Target	Target Info	[1]
	Metastasis associated gene-1 (MTA1)	Literature-reported Target	Target Info	[2]
Protein(s) Regulated by This miRNA	Frataxin, mitochondrial	Regulated Protein	FRDA_HUMAN	[3]
	Metastasis-associated protein MTA2	Regulated Protein	MTA2_HUMAN	[2]
	Vinculin	Regulated Protein	VINC_HUMAN	[2]
References
REF 1	Coordinate suppression of ERBB2 and ERBB3 by enforced expression of micro-RNA miR-125a or miR-125b. J Biol Chem. 2007 Jan 12;282(2):1479-86.
REF 2	MicroRNA-661, a c/EBPalpha target, inhibits metastatic tumor antigen 1 and regulates its functions. Cancer Res. 2009 Jul 15;69(14):5639-42.
REF 3	Genetic variations creating microRNA target sites in the FXN 3'-UTR affect frataxin expression in Friedreich ataxia.PLoS One. 2013;8(1):e54791.
REF 4	MicroRNA-661, a c/EBPalpha target, inhibits metastatic tumor antigen 1 and regulates its functions. Cancer Res. 2009 Jul 15;69(14):5639-42.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.