miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-562 | ||||
| miRNA Stemloop AC | MI0003568 | ||||
| miRNA Stemloop ID | hsa-mir-562 | ||||
| Sequence | aaaguagcuguaccauuugc | ||||
| TTD Target(s) Regulated by This miRNA | Proto-oncogene c-Met (MET) | Successful Target | Target Info | [1] | |
| Presenilin 1 (PSEN1) | Clinical trial Target | Target Info | [1] | ||
| Protein(s) Regulated by This miRNA | Eyes absent homolog 1 | Regulated Protein | [1] | ||
| References | |||||
| REF 1 | Loss of heterozygosity at 2q37 in sporadic Wilms' tumor: putative role for miR-562. Clin Cancer Res. 2009 Oct 1;15(19):5985-92. | ||||
| REF 2 | Loss of heterozygosity at 2q37 in sporadic Wilms' tumor: putative role for miR-562. Clin Cancer Res. 2009 Oct 1;15(19):5985-92. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.