miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-573 | ||||
| miRNA Stemloop AC | MI0003580 | ||||
| miRNA Stemloop ID | hsa-mir-573 | ||||
| Sequence | cugaagugauguguaacugaucag | ||||
| TTD Target(s) Regulated by This miRNA | Fibroblast growth factor receptor 1 (FGFR1) | Successful Target | Target Info | [1] | |
| Cell surface glycoprotein MUC18 (MCAM) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Rho GTPase-activating protein 26 | Regulated Protein | [3] | ||
| Tetraspanin-1 | Regulated Protein | [4] | |||
| References | |||||
| REF 1 | MiR-573 inhibits prostate cancer metastasis by regulating epithelial-mesenchymal transition. Oncotarget. 2015 Nov 3;6(34):35978-90. | ||||
| REF 2 | miR-573 regulates melanoma progression by targeting the melanoma cell adhesion molecule. Oncol Rep. 2013 Jul;30(1):520-6. | ||||
| REF 3 | ADAR1 regulates ARHGAP26 gene expression through RNA editing by disrupting miR-30b-3p and miR-573 binding.RNA. 2013 Nov;19(11):1525-36. | ||||
| REF 4 | TSPAN1 functions as an oncogene in gastric cancer and is downregulated by miR-573.FEBS Lett. 2015 Jul 8;589(15):1988-94. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.