miRNA General Information
miRNA Mature ID	hsa-miR-576-3p
miRNA Stemloop AC	MI0003583
miRNA Stemloop ID	hsa-mir-576
Sequence	aagauguggaaaaauuggaauc
TTD Target(s) Regulated by This miRNA	G1/S-specific cyclin-D1 (CCND1)	Clinical trial Target	Target Info	[1]
References
REF 1	MicroRNA-576-3p inhibits proliferation in bladder cancer cells by targeting cyclin D1. Mol Cells. 2015;38(2):130-7.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.