miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-582-3p | ||||
| miRNA Stemloop AC | MI0003589 | ||||
| miRNA Stemloop ID | hsa-mir-582 | ||||
| Sequence | uaacugguugaacaacugaacc | ||||
| TTD Target(s) Regulated by This miRNA | Leucine-rich repeat kinase 2 (LRRK2) | Clinical trial Target | Target Info | [1] | |
| Dickkopf-related protein 3 (DKK3) | Clinical trial Target | Target Info | [2] | ||
| Geranylgeranyl transferase I (GGTase-I) | Clinical trial Target | Target Info | [1] | ||
| Voltage-gated potassium channel Kv3.1 (KCNC1) | Literature-reported Target | Target Info | [1] | ||
| Protein(s) Regulated by This miRNA | Axin-2 | Regulated Protein | [2] | ||
| Dixin | Regulated Protein | [1] | |||
| Ras-related protein Rab-27A | Regulated Protein | [1] | |||
| Secreted frizzled-related protein 1 | Regulated Protein | [2] | |||
| References | |||||
| REF 1 | Therapeutic effects of microRNA-582-5p and -3p on the inhibition of bladder cancer progression. Mol Ther. 2013 Mar;21(3):610-9. | ||||
| REF 2 | Aberrantly expressed miR-582-3p maintains lung cancer stem cell-like traits by activating Wnt/-catenin signalling. Nat Commun. 2015 Oct 15;6:8640. | ||||
| REF 3 | Aberrantly expressed miR-582-3p maintains lung cancer stem cell-like traits by activating Wnt/-catenin signalling. Nat Commun. 2015 Oct 15;6:8640. | ||||
| REF 4 | Therapeutic effects of microRNA-582-5p and -3p on the inhibition of bladder cancer progression. Mol Ther. 2013 Mar;21(3):610-9. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.