miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-582-5p | ||||
| miRNA Stemloop AC | MI0003589 | ||||
| miRNA Stemloop ID | hsa-mir-582 | ||||
| Sequence | uuacaguuguucaaccaguuacu | ||||
| TTD Target(s) Regulated by This miRNA | Caspase-3 (CASP3) | Clinical trial Target | Target Info | [1] | |
| Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) | Clinical trial Target | Target Info | [2] | ||
| Caspase-9 (CASP9) | Clinical trial Target | Target Info | [1] | ||
| Leucine-rich repeat kinase 2 (LRRK2) | Clinical trial Target | Target Info | [3] | ||
| Geranylgeranyl transferase I (GGTase-I) | Clinical trial Target | Target Info | [3] | ||
| Cyclic AMP-responsive element-binding protein (CREB1) | Literature-reported Target | Target Info | [4] | ||
| Voltage-gated potassium channel Kv3.1 (KCNC1) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Dixin | Regulated Protein | [3] | ||
| Ephrin-B2 | Regulated Protein | [6] | |||
| Ras-related protein Rab-27A | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | Novel anti-apoptotic microRNAs 582-5p and 363 promote human glioblastoma stem cell survival via direct inhibition of caspase 3, caspase 9, and Bim. PLoS One. 2014 May 7;9(5):e96239. | ||||
| REF 2 | A microRNA screen to identify modulators of sensitivity to BCL2 inhibitor ABT-263 (navitoclax). Mol Cancer Ther. 2010 Nov;9(11):2943-50. | ||||
| REF 3 | Therapeutic effects of microRNA-582-5p and -3p on the inhibition of bladder cancer progression. Mol Ther. 2013 Mar;21(3):610-9. | ||||
| REF 4 | MiR-582-5p/miR-590-5p targeted CREB1/CREB5-NF-B signaling and caused opioid-induced immunosuppression in human monocytes. Transl Psychiatry. 2016 Mar 15;6:e757. | ||||
| REF 5 | Therapeutic effects of microRNA-582-5p and -3p on the inhibition of bladder cancer progression. Mol Ther. 2013 Mar;21(3):610-9. | ||||
| REF 6 | Up-regulation of miR-582-5p regulates cellular proliferation of prostate cancer cells under androgen-deprived conditions.Prostate. 2014 Dec;74(16):1604-12. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.