miRNA General Information
miRNA Mature ID	hsa-miR-584-3p
miRNA Stemloop AC	MI0003591
miRNA Stemloop ID	hsa-mir-584
Sequence	ucaguuccaggccaaccaggcu
TTD Target(s) Regulated by This miRNA	Rho-associated protein kinase 1 (ROCK1)	Successful Target	Target Info	[1]
References
REF 1	MicroRNA-584-3p, a novel tumor suppressor and prognostic marker, reduces the migration and invasion of human glioma cells by targeting hypoxia-induced ROCK1. Oncotarget. 2016 Jan 26;7(4):4785-805.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.