miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-608 | ||||
| miRNA Stemloop AC | MI0003621 | ||||
| miRNA Stemloop ID | hsa-mir-608 | ||||
| Sequence | aggggugguguugggacagcuccgu | ||||
| TTD Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-xL (BCL-xL) | Clinical trial Target | Target Info | [1] | |
| Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [2] | ||
| Extracellular matrix receptor III (CD44) | Clinical trial Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Cell division control protein 42 homolog | Regulated Protein | [3] | ||
| F-box only protein 32 | Regulated Protein | [5] | |||
| N-alpha-acetyltransferase 10 | Regulated Protein | [6] | |||
| References | |||||
| REF 1 | MicroRNA library screening identifies growth-suppressive microRNAs that regulate genes involved in cell cycle progression and apoptosis. Exp Cell Res. 2015 Dec 10;339(2):320-32. | ||||
| REF 2 | Negative regulation of tumor suppressor p53 by microRNA miR-504. Mol Cell. 2010 Jun 11;38(5):689-99. | ||||
| REF 3 | Expression of CD44 3'-untranslated region regulates endogenous microRNA functions in tumorigenesis and angiogenesis. Nucleic Acids Res. 2011 Apr;39(8):3026-41. | ||||
| REF 4 | Expression of CD44 3'-untranslated region regulates endogenous microRNA functions in tumorigenesis and angiogenesis. Nucleic Acids Res. 2011 Apr;39(8):3026-41. | ||||
| REF 5 | A sequence polymorphism in miR-608 predicts recurrence after radiotherapy for nasopharyngeal carcinoma.Cancer Res. 2013 Aug 15;73(16):5151-62. | ||||
| REF 6 | microRNA-342-5p and miR-608 inhibit colon cancer tumorigenesis by targeting NAA10.Oncotarget. 2016 Jan 19;7(3):2709-20. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.