miRNA General Information
miRNA Mature ID	hsa-miR-616-5p
miRNA Stemloop AC	MI0003629
miRNA Stemloop ID	hsa-mir-616
Sequence	acucaaaacccuucagugacuu
TTD Target(s) Regulated by This miRNA	Glycogen synthase kinase-3 beta (GSK-3B)	Clinical trial Target	Target Info	[1]
References
REF 1	Sulforaphane suppresses EMT and metastasis in human lung cancer through miR-616-5p-mediated GSK3/-catenin signaling pathways. Acta Pharmacol Sin. 2017 Feb;38(2):241-251.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.