miRNA General Information
miRNA Mature ID	hsa-miR-622
miRNA Stemloop AC	MI0003636
miRNA Stemloop ID	hsa-mir-622
Sequence	acagucugcugagguuggagc
TTD Target(s) Regulated by This miRNA	C-X-C chemokine receptor type 4 (CXCR4)	Successful Target	Target Info	[1]
	Urokinase plasminogen activator surface receptor (PLAUR)	Successful Target	Target Info	[1]
	Laminin gamma-2 subunit (LAMC2)	Literature-reported Target	Target Info	[2]
References
REF 1	Urokinase receptor and CXCR4 are regulated by common microRNAs in leukaemia cells. J Cell Mol Med. 2015 Sep;19(9):2262-72.
REF 2	Nuclear Drosha enhances cell invasion via an EGFR-ERK1/2-MMP7 signaling pathway induced by dysregulated miRNA-622/197 and their targets LAMC2 and CD82 in gastric cancer. Cell Death Dis. 2017 Mar 2;8(3):e2642.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.