miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-629-5p | ||||
| miRNA Stemloop AC | MI0003643 | ||||
| miRNA Stemloop ID | hsa-mir-629 | ||||
| Sequence | uggguuuacguugggagaacu | ||||
| TTD Target(s) Regulated by This miRNA | Hepatocyte nuclear factor 4-alpha (HNF4A) | Literature-reported Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | E3 ubiquitin-protein ligase TRIM33 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | An HNF4-miRNA inflammatory feedback circuit regulates hepatocellular oncogenesis. Cell. 2011 Dec 9;147(6):1233-47. | ||||
| REF 2 | miR-629 Targets TRIM33 to Promote TGF/Smad Signaling and Metastatic Phenotypes in ccRCC.Mol Cancer Res. 2015 Mar;13(3):565-74. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.