miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-663b | ||||
| miRNA Stemloop AC | MI0006336 | ||||
| miRNA Stemloop ID | hsa-mir-663b | ||||
| Sequence | gguggcccggccgugccugagg | ||||
| TTD Target(s) Regulated by This miRNA | Insulin-like growth factor-II (IGF2) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Elongation factor 1-alpha 2 | Regulated Protein | [2] | ||
| G1/S-specific cyclin-D2 | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | Epigenetic inhibition of miR-663b by long non-coding RNA HOTAIR promotes pancreatic cancer cell proliferation via up-regulation of insulin-like growth factor 2. Oncotarget. 2016 Dec 27;7(52):86857-86870. | ||||
| REF 2 | miR-663 attenuates tumor growth and invasiveness by targeting eEF1A2 in pancreatic cancer.Mol Cancer. 2015 Feb 13;14:37. | ||||
| REF 3 | Specific alterations of the microRNA transcriptome and global network structure in colorectal cancer after treatment with MAPK/ERK inhibitors. J Mol Med (Berl). 2012 Dec;90(12):1421-38. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.