miRNA General Information
miRNA Mature ID	hsa-miR-7-1-3p
miRNA Stemloop AC	MI0000263
miRNA Stemloop ID	hsa-mir-7-1
Sequence	caacaaaucacagucugccaua
TTD Target(s) Regulated by This miRNA	Epidermal growth factor receptor (EGFR)	Successful Target	Target Info	[1]
	Insulin-like growth factor I receptor (IGF1R)	Successful Target	Target Info	[1]
	Proto-oncogene c-RAF (c-RAF)	Clinical trial Target	Target Info	[1]
	Inward rectifier potassium channel Kir2.1 (KCNJ2)	Literature-reported Target	Target Info	[2]
References
REF 1	miR-7 reverses the resistance to BRAFi in melanoma by targeting EGFR/IGF-1R/CRAF and inhibiting the MAPK and PI3K/AKT signaling pathways. Oncotarget. 2016 Aug 16;7(33):53558-53570.
REF 2	Upregulation of the inwardly rectifying potassium channel Kir2.1 (KCNJ2) modulates multidrug resistance of small-cell lung cancer under the regulation of miR-7 and the Ras/MAPK pathway. Mol Cancer. 2015 Mar 12;14:59.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.