miRNA General Information
miRNA Mature ID hsa-miR-708-5p
miRNA Stemloop AC MI0005543
miRNA Stemloop ID hsa-mir-708
Sequence aaggagcuuacaaucuagcuggg
TTD Target(s) Regulated by This miRNA Matrix metalloproteinase-2 (MMP-2) Successful Target Target Info [1]
Poly [ADP-ribose] polymerase 1 (PARP1) Successful Target Target Info [1]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [1]
Programmed cell death 1 ligand 1 (PD-L1) Successful Target Target Info [2]
Mothers against decapentaplegic homolog 3 (SMAD3) Successful Target Target Info [3]
RAC-alpha serine/threonine-protein kinase (AKT1) Clinical trial Target Target Info [1]
Apoptosis inhibitor survivin (BIRC5) Clinical trial Target Target Info [4]
Enhancer of zeste homolog 2 (EZH2) Successful Target Target Info [1]
Lysine-specific histone demethylase 1 (LSD) Clinical trial Target Target Info [5]
Ciliary neurotrophic factor receptor alpha (CNTFR) Clinical trial Target Target Info [6]
G1/S-specific cyclin-D1 (CCND1) Clinical trial Target Target Info [1]
Extracellular matrix receptor III (CD44) Clinical trial Target Target Info [7]
Caspase-2 (CASP2) Patented-recorded Target Target Info [8]
RAC-beta serine/threonine-protein kinase (AKT2) Literature-reported Target Target Info [7]
Polycomb complex protein BMI-1 (BMI1) Literature-reported Target Target Info [9]
Zinc finger E-box-binding homeobox 2 (ZEB2) Literature-reported Target Target Info [10]
Protein(s) Regulated by This miRNA Eyes absent homolog 3 Regulated Protein [11]
Neuronatin Regulated Protein [12]
NF-kappa-B essential modulator Regulated Protein [13]
Transmembrane protein 88 Regulated Protein [14]
References
REF 1 miR-708 acts as a tumor suppressor in human glioblastoma cells. Oncol Rep. 2013 Aug;30(2):870-6.
REF 2 Identifying microRNAs regulating B7-H3 in breast cancer: the clinical impact of microRNA-29c. Br J Cancer. 2014 Apr 15;110(8):2072-80.
REF 3 MiR-708 promotes steroid-induced osteonecrosis of femoral head, suppresses osteogenic differentiation by targeting SMAD3. Sci Rep. 2016 Mar 2;6:22599.
REF 4 MicroRNA-708 induces apoptosis and suppresses tumorigenicity in renal cancer cells. Cancer Res. 2011 Oct 1;71(19):6208-19.
REF 5 miR-708/LSD1 axis regulates the proliferation and invasion of breast cancer cells. Cancer Med. 2016 Apr;5(4):684-92.
REF 6 Overexpression of miR-708 and its targets in the childhood common precursor B-cell ALL. Pediatr Blood Cancer. 2013 Dec;60(12):2060-7.
REF 7 miRNA-708 control of CD44(+) prostate cancer-initiating cells. Cancer Res. 2012 Jul 15;72(14):3618-30.
REF 8 miR-708 promotes the development of bladder carcinoma via direct repression of Caspase-2. J Cancer Res Clin Oncol. 2013 Jul;139(7):1189-98.
REF 9 Targeting of the Bmi-1 oncogene/stem cell renewal factor by microRNA-128 inhibits glioma proliferation and self-renewal. Cancer Res. 2008 Nov 15;68(22):9125-30.
REF 10 The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat Cell Biol. 2008 May;10(5):593-601.
REF 11 EWS/FLI1 regulates EYA3 in Ewing sarcoma via modulation of miRNA-708, resulting in increased cell survival and chemoresistance.Mol Cancer Res. 2012 Aug;10(8):1098-108.
REF 12 Suppression of miRNA-708 by polycomb group promotes metastases by calcium-induced cell migration.Cancer Cell. 2013 Jan 14;23(1):63-76.
REF 13 MicroRNA mediation of endothelial inflammatory response to smooth muscle cells and its inhibition by atheroprotective shear stress. Circ Res. 2015 Mar 27;116(7):1157-69.
REF 14 Increased miR-708 expression in NSCLC and its association with poor survival in lung adenocarcinoma from never smokers.Clin Cancer Res. 2012 Jul 1;18(13):3658-67.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.