miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-718 | ||||
| miRNA Stemloop AC | MI0012489 | ||||
| miRNA Stemloop ID | hsa-mir-718 | ||||
| Sequence | cuuccgccccgccgggcgucg | ||||
| TTD Target(s) Regulated by This miRNA | Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [1] | |
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Homeobox protein Hox-B8 | Regulated Protein | [3] | ||
| References | |||||
| REF 1 | MiR-718 represses VEGF and inhibits ovarian cancer cell progression. FEBS Lett. 2014 Jun 5;588(12):2078-86. | ||||
| REF 2 | HIV-1 Nef and KSHV oncogene K1 synergistically promote angiogenesis by inducing cellular miR-718 to regulate the PTEN/AKT/mTOR signaling pathway. Nucleic Acids Res. 2014 Sep;42(15):9862-79. | ||||
| REF 3 | Identification of a bona fide microRNA biomarker in serum exosomes that predicts hepatocellular carcinoma recurrence after liver transplantation.Br J Cancer. 2015 Feb 3;112(3):532-8. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.