miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-769-5p | ||||
| miRNA Stemloop AC | MI0003834 | ||||
| miRNA Stemloop ID | hsa-mir-769 | ||||
| Sequence | ugagaccucuggguucugagcu | ||||
| TTD Target(s) Regulated by This miRNA | Glycogen synthase kinase-3 beta (GSK-3B) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Trafficking protein particle complex subunit 2B | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | MiR-769 promoted cell proliferation in human melanoma by suppressing GSK3B expression. Biomed Pharmacother. 2016 Aug;82:117-23. | ||||
| REF 2 | MicroRNAs are differentially expressed in ulcerative colitis and alter expression of macrophage inflammatory peptide-2 alpha.Gastroenterology. 2008 Nov;135(5):1624-1635.e24. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.