miRNA General Information
miRNA Mature ID	hsa-miR-875-5p
miRNA Stemloop AC	MI0005541
miRNA Stemloop ID	hsa-mir-875
Sequence	uauaccucaguuuuaucaggug
TTD Target(s) Regulated by This miRNA	Epidermal growth factor receptor (EGFR)	Successful Target	Target Info	[1]
References
REF 1	Hsa-miR-875-5p exerts tumor suppressor function through down-regulation of EGFR in colorectal carcinoma (CRC). Oncotarget. 2016 Jul 5;7(27):42225-42240.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.