miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-892b | ||||
| miRNA Stemloop AC | MI0005538 | ||||
| miRNA Stemloop ID | hsa-mir-892b | ||||
| Sequence | cacuggcuccuuucuggguaga | ||||
| TTD Target(s) Regulated by This miRNA | Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [1] | |
| Matrix metalloproteinase-9 (MMP-9) | Clinical trial Target | Target Info | [1] | ||
| Cyclin-dependent kinase 2 (CDK2) | Clinical trial Target | Target Info | [1] | ||
| Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) | Clinical trial Target | Target Info | [2] | ||
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [1] | ||
| Transcription factor Sp1 (SP1) | Clinical trial Target | Target Info | [1] | ||
| TGF-beta-activated kinase 1 (MAP3K7) | Literature-reported Target | Target Info | [3] | ||
| G1/S-specific cyclin-E1 (CCNE1) | Literature-reported Target | Target Info | [1] | ||
| Protein(s) Regulated by This miRNA | TGF-beta-activated kinase 1 and MAP3K7-binding protein 3 | Regulated Protein | [3] | ||
| TNF receptor-associated factor 2 | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | MicroRNA-892b influences proliferation, migration and invasion of bladder cancer cells by mediating the p19ARF/cyclin D1/CDK6 and Sp-1/MMP-9 pathways. Oncol Rep. 2016 Oct;36(4):2313-20. | ||||
| REF 2 | A microRNA screen to identify modulators of sensitivity to BCL2 inhibitor ABT-263 (navitoclax). Mol Cancer Ther. 2010 Nov;9(11):2943-50. | ||||
| REF 3 | miR-892b Silencing Activates NF-B and Promotes Aggressiveness in Breast Cancer. Cancer Res. 2016 Mar 1;76(5):1101-11. | ||||
| REF 4 | miR-892b Silencing Activates NF-B and Promotes Aggressiveness in Breast Cancer. Cancer Res. 2016 Mar 1;76(5):1101-11. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.