miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-92a-2-5p | ||||
| miRNA Stemloop AC | MI0000094 | ||||
| miRNA Stemloop ID | hsa-mir-92a-2 | ||||
| Sequence | ggguggggauuuguugcauuac | ||||
| TTD Target(s) Regulated by This miRNA | Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [1] | |
| Apoptosis mediating surface antigen FAS (FAS) | Clinical trial Target | Target Info | [1] | ||
| Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [1] | ||
| Protein(s) Regulated by This miRNA | Bcl-2-like protein 11 | Regulated Protein | [1] | ||
| References | |||||
| REF 1 | Upregulation of the miR-17-92 cluster and its two paraloga in osteosarcoma - reasons and consequences. Genes Cancer. 2014 Apr;5(1-2):56-63. | ||||
| REF 2 | Upregulation of the miR-17-92 cluster and its two paraloga in osteosarcoma - reasons and consequences. Genes Cancer. 2014 Apr;5(1-2):56-63. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.