miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-942-3p | ||||
| miRNA Stemloop AC | MI0005767 | ||||
| miRNA Stemloop ID | hsa-mir-942 | ||||
| Sequence | cacauggccgaaacagagaagu | ||||
| TTD Target(s) Regulated by This miRNA | Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [1] | |
| Matrix metalloproteinase-9 (MMP-9) | Clinical trial Target | Target Info | [1] | ||
| References | |||||
| REF 1 | Identification of tissue microRNAs predictive of sunitinib activity in patients with metastatic renal cell carcinoma. PLoS One. 2014 Jan 24;9(1):e86263. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.