miRNA General Information
miRNA Mature ID	hsa-miR-942-5p
miRNA Stemloop AC	MI0005767
miRNA Stemloop ID	hsa-mir-942
Sequence	ucuucucuguuuuggccaugug
TTD Target(s) Regulated by This miRNA	Glycogen synthase kinase-3 beta (GSK-3B)	Clinical trial Target	Target Info	[1]
	Melanoma differentiation-associated protein 6 (CDKN1A)	Literature-reported Target	Target Info	[2]
	Secreted frizzled related protein-4 (SFRP4)	Literature-reported Target	Target Info	[1]
Protein(s) Regulated by This miRNA	Interferon alpha-inducible protein 27, mitochondrial	Regulated Protein	IFI27_HUMAN	[3]
	Interferon alpha-inducible protein 27, mitochondrial	Regulated Protein	IFI27_HUMAN	[4]
	NF-kappa-B inhibitor alpha	Regulated Protein	IKBA_HUMAN	[5]
	Transducin-like enhancer protein 1	Regulated Protein	TLE1_HUMAN	[1]
References
REF 1	miR-942 promotes cancer stem cell-like traits in esophageal squamous cell carcinoma through activation of Wnt/-catenin signalling pathway. Oncotarget. 2015 May 10;6(13):10964-77.
REF 2	Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Oncogene. 2010 Apr 15;29(15):2302-8.
REF 3	MiR-942 mediates hepatitis C virus-induced apoptosis via regulation of ISG12a.PLoS One. 2014 Apr 11;9(4):e94501.
REF 4	miR-942 decreases TRAIL-induced apoptosis through ISG12a downregulation and is regulated by AKT.Oncotarget. 2014 Jul 15;5(13):4959-71.
REF 5	HIV-1 Vpr Inhibits Kaposi's Sarcoma-Associated Herpesvirus Lytic Replication by Inducing MicroRNA miR-942-5p and Activating NF-B Signaling.J Virol. 2016 Sep 12;90(19):8739-53.
REF 6	miR-942 promotes cancer stem cell-like traits in esophageal squamous cell carcinoma through activation of Wnt/-catenin signalling pathway. Oncotarget. 2015 May 10;6(13):10964-77.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.