miRNA General Information
miRNA Mature ID	hsa-miR-99b-3p
miRNA Stemloop AC	MI0000746
miRNA Stemloop ID	hsa-mir-99b
Sequence	caagcucgugucuguggguccg
TTD Target(s) Regulated by This miRNA	Glycogen synthase kinase-3 beta (GSK-3B)	Clinical trial Target	Target Info	[1]
References
REF 1	miRNA-99b-3p functions as a potential tumor suppressor by targeting glycogen synthase kinase-3 in oral squamous cell carcinoma Tca-8113 cells. Int J Oncol. 2015 Oct;47(4):1528-36.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.