miRNA General Information
miRNA Mature ID	hsa-miR-99b-5p
miRNA Stemloop AC	MI0000746
miRNA Stemloop ID	hsa-mir-99b
Sequence	cacccguagaaccgaccuugcg
TTD Target(s) Regulated by This miRNA	Serine/threonine-protein kinase mTOR (mTOR)	Successful Target	Target Info	[1]
	Insulin-like growth factor I receptor (IGF1R)	Successful Target	Target Info	[2]
	NADPH oxidase 4 (NOX4)	Clinical trial Target	Target Info	[3]
Protein(s) Regulated by This miRNA	AT-rich interactive domain-containing protein 3A	Regulated Protein	ARI3A_HUMAN	[4]
	Grainyhead-like protein 1 homolog	Regulated Protein	GRHL1_HUMAN	[5]
	Ribonucleoprotein PTB-binding 2	Regulated Protein	RAVR2_HUMAN	[6]
	Serine/threonine-protein phosphatase PP1-beta catalytic subunit	Regulated Protein	PP1B_HUMAN	[5]
References
REF 1	miR-99a and -99b inhibit cervical cancer cell proliferation and invasion by targeting mTOR signaling pathway. Med Oncol. 2014 May;31(5):934.
REF 2	miR-99b suppresses IGF-1R expression and contributes to inhibition of cell proliferation in human epidermal keratinocytes. Biomed Pharmacother. 2015 Oct;75:159-64.
REF 3	Chronic administration of 9-tetrahydrocannabinol induces intestinal anti-inflammatory microRNA expression during acute simian immunodeficiency virus infection of rhesus macaques. J Virol. 2015 Jan 15;89(2):1168-81.
REF 4	ZEB1 induced miR-99b/let-7e/miR-125a cluster promotes invasion and metastasis in esophageal squamous cell carcinoma.Cancer Lett. 2017 Jul 10;398:37-45.
REF 5	MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 6	Identification of human microRNA targets from isolated argonaute protein complexes.RNA Biol. 2007 Jun;4(2):76-84.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.