Target Regulator(s) Information (MicroRNA)
Target General Information | |||||
---|---|---|---|---|---|
Target ID | T14597 | Target Info | |||
Target Name | Erbb2 tyrosine kinase receptor (HER2) | ||||
Synonyms | p185erbB2; Tyrosine kinase-type cell surface receptor HER2; Receptor tyrosine-protein kinase erbB-2; Proto-oncogene c-ErbB-2; Proto-oncogene Neu; NGL; NEU; Metastatic lymph node gene 19 protein; MLN19; MLN 19; HER2; CD340 | ||||
Target Type | Successful Target | ||||
Gene Name | ERBB2 | ||||
Biochemical Class | Kinase | ||||
UniProt ID | |||||
The microRNAs (miRNAs) Regulating This Target | |||||
miRNA Mature ID | hsa-miR-331-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | gccccugggccuauccuagaa | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | The overexpression of miR-331-3p by mature miRNA precursor transfection resulted in the decreased protein level of target ERBB2. | [2] | |||
Evidence Score (E-score) | 5 | + | |||
1 | Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot | [1] | |||
2 | Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot | [2] | |||
3 | Luciferase Reporter Assay | [3] | |||
4 | Luciferase Reporter Assay; Microarray; Western Blot | [4] | |||
5 | Luciferase Reporter Assay; Western Blot | [5] | |||
Representative Target(s) Regulated by This miRNA | E2F transcription factor 1 (E2F1) | Target Info | |||
Erbb2 tyrosine kinase receptor (HER2) | Target Info | ||||
miRNA Mature ID | hsa-miR-125a-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | ucccugagacccuuuaaccuguga | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | The overexpression of miR-125a-5p by mature miRNA transfection resulted in the decreased protein level of target ERBB2. | [2] | |||
Evidence Score (E-score) | 4 | + | |||
1 | Luciferase Reporter Assay | [6] | |||
2 | Luciferase Reporter Assay | [2] | |||
3 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [7] | |||
4 | Western Blot; qRT-PCR | [8] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis regulator BAK (BAK) | Target Info | |||
Apoptosis regulator Bcl-2 (BCL-2) | Target Info | ||||
miRNA Mature ID | hsa-miR-125b-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | ucccugagacccuaacuuguga | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | The overexpression of miR-125b-5p by mature miRNA transfection resulted in the decreased protein level of target ERBB2. | [2] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [9] | |||
2 | Western Blot; Northern Blot; Luciferase Reporter Assay | [2] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis regulator BAK (BAK) | Target Info | |||
Cyclin-dependent kinase 6 (CDK6) | Target Info | ||||
miRNA Mature ID | hsa-miR-193a-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | ugggucuuugcgggcgagauga | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-193a-5p directly regulated HER2 by interacting with the 3-UTR. | [3] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay | [10] | |||
2 | Luciferase Reporter Assay | [3] | |||
Representative Target(s) Regulated by This miRNA | AP-2 transcription factor (TFAP2A) | Target Info | |||
Erbb2 tyrosine kinase receptor (HER2) | Target Info | ||||
miRNA Mature ID | hsa-miR-205-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uccuucauuccaccggagucug | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | Overexpression of erbB2 induces anchorage-independent growth in breast epithelial cells due to the deduction of miR-205. | [12] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [11] | |||
2 | qRT-PCR; Western Blot | [12] | |||
Representative Target(s) Regulated by This miRNA | Androgen receptor (AR) | Target Info | |||
Apoptosis regulator Bcl-2 (BCL-2) | Target Info | ||||
miRNA Mature ID | hsa-miR-559 | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uaaaguaaauaugcaccaaaa | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay | [13] | |||
2 | Luciferase Reporter Assay | [2] | |||
Representative Target(s) Regulated by This miRNA | Erbb2 tyrosine kinase receptor (HER2) | Target Info | |||
Metastasis associated gene-1 (MTA1) | Target Info | ||||
miRNA Mature ID | hsa-miR-1296-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uuagggcccuggcuccaucucc | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-1296-5p might be involved in the regulation on the migration and invasion of human gastric cancer cells at least in part via targeting ERBB2 signaling pathway. | [15] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Dual Luciferase Reporter Assay; Western Blot | [14] | |||
2 | Luciferase Reporter Assay; Western Blot | [15] | |||
Representative Target(s) Regulated by This miRNA | Erbb2 tyrosine kinase receptor (HER2) | Target Info | |||
miRNA Mature ID | hsa-miR-130b-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | cagugcaaugaugaaagggcau | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-130b-3p promotes TGF-b1-induced EMT in renal tubular epithelial cells by targeting ERBB2IP. | [16] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay | [16] | |||
Representative Target(s) Regulated by This miRNA | Acyl-CoA desaturase (SCD) | Target Info | |||
Cyclin A2 (CCNA2) | Target Info | ||||
miRNA Mature ID | hsa-miR-134-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | ugugacugguugaccagagggg | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-134 directly regulated HER2 by interacting with the 3-UTR. | [3] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay | [3] | |||
Representative Target(s) Regulated by This miRNA | Angiopoietin-related protein 4 (ANGPTL4) | Target Info | |||
Erbb2 tyrosine kinase receptor (HER2) | Target Info | ||||
miRNA Mature ID | hsa-miR-155-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | cuccuacauauuagcauuaaca | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-155 directly targets ErbB2 via a regulatory element in its coding region. | [17] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [17] | |||
Representative Target(s) Regulated by This miRNA | Cellular tumor antigen p53 (TP53) | Target Info | |||
Erbb2 tyrosine kinase receptor (HER2) | Target Info | ||||
miRNA Mature ID | hsa-miR-193a-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aacuggccuacaaagucccagu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-193a-5p directly regulated HER2 by interacting with the 3-UTR. | [3] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay | [3] | |||
Representative Target(s) Regulated by This miRNA | E2F transcription factor 1 (E2F1) | Target Info | |||
Erbb2 tyrosine kinase receptor (HER2) | Target Info | ||||
miRNA Mature ID | hsa-miR-199b-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | cccaguguuuagacuaucuguuc | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-199b-5p direct targets HER2 in breast cancer cell. | [18] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [18] | |||
Representative Target(s) Regulated by This miRNA | Epithelial discoidin domain receptor 1 (DDR1) | Target Info | |||
Erbb2 tyrosine kinase receptor (HER2) | Target Info | ||||
miRNA Mature ID | hsa-miR-21-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uagcuuaucagacugauguuga | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 1 | + | |||
1 | qRT-PCR; Western Blot | [19] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis antigen ligand (CD178) | Target Info | |||
Apoptosis regulator Bcl-2 (BCL-2) | Target Info | ||||
miRNA Mature ID | hsa-miR-22-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aagcugccaguugaagaacugu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-22 can regulate ErbB2 by binding to the 3'UTR of ErbB2. | [20] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay | [20] | |||
Representative Target(s) Regulated by This miRNA | 5-HT 2C receptor (HTR2C) | Target Info | |||
ATP-citrate synthase (ACLY) | Target Info | ||||
miRNA Mature ID | hsa-miR-25-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | cauugcacuugucucggucuga | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-25 promotes gastric cancer progression by directly downregulating TOB1 expression. | [21] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [21] | |||
Representative Target(s) Regulated by This miRNA | CDK inhibitor 1C p57Kip2 (CDKN1C) | Target Info | |||
Cellular tumor antigen p53 (TP53) | Target Info | ||||
miRNA Mature ID | hsa-miR-34a-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uggcagugucuuagcugguugu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | A luciferase reporter assay was done to understand the potential correlation between ErbB2 and miR-34a. | [22] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [22] | |||
Representative Target(s) Regulated by This miRNA | Amphiregulin (AREG) | Target Info | |||
Androgen receptor (AR) | Target Info | ||||
miRNA Mature ID | hsa-miR-3622b-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aggcaugggaggucagguga | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-3622b-5p is involved in the proliferation and apoptosis of human ERBB2-positive cancer cells via targeting ERBB2/mTORC1 signaling pathway. | [23] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [23] | |||
Representative Target(s) Regulated by This miRNA | Epidermal growth factor receptor (EGFR) | Target Info | |||
Erbb2 tyrosine kinase receptor (HER2) | Target Info | ||||
miRNA Mature ID | hsa-miR-541-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uggugggcacagaaucuggacu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-541 directly regulated HER2 by interacting with the 3-UTR. | [3] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay | [3] | |||
Representative Target(s) Regulated by This miRNA | Erbb2 tyrosine kinase receptor (HER2) | Target Info | |||
Voltage-gated calcium channel alpha Cav2.3 (CACNA1E) | Target Info | ||||
miRNA Mature ID | hsa-miR-552-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aacaggugacugguuagacaa | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-552 directly regulated HER2 by interacting with the 3-UTR. | [3] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay | [3] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis inhibitor survivin (BIRC5) | Target Info | |||
Erbb2 tyrosine kinase receptor (HER2) | Target Info | ||||
miRNA Mature ID | hsa-miR-323b-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | agguuguccguggugaguucgca | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay | [3] | |||
Representative Target(s) Regulated by This miRNA | Erbb2 tyrosine kinase receptor (HER2) | Target Info | |||
miRNA Mature ID | hsa-miR-548d-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | caaaaaccacaguuucuuuugc | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay | [2] | |||
Representative Target(s) Regulated by This miRNA | Erbb2 tyrosine kinase receptor (HER2) | Target Info | |||
References | |||||
REF 1 | Lnc RNA HOTAIR functions as a competing endogenous RNA to regulate HER2 expression by sponging miR-331-3p in gastric cancer. Mol Cancer. 2014 Apr 28;13:92. | ||||
REF 2 | Coordinate suppression of ERBB2 and ERBB3 by enforced expression of micro-RNA miR-125a or miR-125b. J Biol Chem. 2007 Jan 12;282(2):1479-86. | ||||
REF 3 | High-throughput screens identify microRNAs essential for HER2 positive breast cancer cell growth. Mol Oncol. 2014 Feb;8(1):93-104. | ||||
REF 4 | Regulation of ErbB receptor signalling in cancer cells by microRNA. Curr Opin Pharmacol. 2010 Dec;10(6):655-61. | ||||
REF 5 | MiR-331-3p inhibits proliferation and promotes apoptosis by targeting HER2 through the PI3K/Akt and ERK1/2 pathways in colorectal cancer. Oncol Rep. 2016 Feb;35(2):1075-82. | ||||
REF 6 | MicroRNA-125a-5p is an independent prognostic factor in gastric cancer and inhibits the proliferation of human gastric cancer cells in combination with trastuzumab. Clin Cancer Res. 2011 May 1;17(9):2725-33. | ||||
REF 7 | Chemotherapy-Regulated microRNA-125-HER2 Pathway as a Novel Therapeutic Target for Trastuzumab-Mediated Cellular Cytotoxicity in Small Cell Lung Cancer. Mol Cancer Ther. 2015 Jun;14(6):1414-23. | ||||
REF 8 | Functional cooperation of miR-125a, miR-125b, and miR-205 in entinostat-induced downregulation of erbB2/erbB3 and apoptosis in breast cancer cells. Cell Death Dis. 2013 Mar 21;4:e556. | ||||
REF 9 | MicroRNA-125b down-regulation mediates endometrial cancer invasion by targeting ERBB2. Med Sci Monit. 2012 Apr;18(4):BR149-55. | ||||
REF 10 | MiR-193a-5p/ERBB2 act as concurrent chemoradiation therapy response indicator of esophageal squamous cell carcinoma. Oncotarget. 2016 Jun 28;7(26):39680-39693. | ||||
REF 11 | miR-205-5p-mediated downregulation of ErbB/HER receptors in breast cancer stem cells results in targeted therapy resistance. Cell Death Dis. 2015 Jul 16;6:e1823. | ||||
REF 12 | ErbB2 down-regulates microRNA-205 in breast cancer. Biochem Biophys Res Commun. 2011 Aug 12;411(4):804-8. | ||||
REF 13 | Preliminary validation of ERBB2 expression regulated by miR-548d-3p and miR-559. Biochem Biophys Res Commun. 2009 Aug 7;385(4):596-600. | ||||
REF 14 | miR-1296-5p decreases ERBB2 expression to inhibit the cell proliferation in ERBB2-positive breast cancer. Cancer Cell Int. 2017 Oct 24;17:95. | ||||
REF 15 | miR 1296-5p Inhibits the Migration and Invasion of Gastric Cancer Cells by Repressing ERBB2 Expression. PLoS One. 2017 Jan 18;12(1):e0170298. | ||||
REF 16 | Up-regulation of Serum MiR-130b-3p Level is Associated with Renal Damage in Early Lupus Nephritis. Sci Rep. 2015 Aug 28;5:12644. | ||||
REF 17 | miR-155 downregulates ErbB2 and suppresses ErbB2-induced malignant transformation of breast epithelial cells. Oncogene. 2016 Nov 17;35(46):6015-6025. | ||||
REF 18 | MiR-199b-5p targets HER2 in breast cancer cells. J Cell Biochem. 2013 Jul;114(7):1457-63. | ||||
REF 19 | Up-regulation of miR-21 by HER2/neu signaling promotes cell invasion. J Biol Chem. 2009 Jul 3;284(27):18515-24. | ||||
REF 20 | Dual Action of miR-125b As a Tumor Suppressor and OncomiR-22 Promotes Prostate Cancer Tumorigenesis. PLoS One. 2015 Nov 6;10(11):e0142373. | ||||
REF 21 | MicroRNA-25 promotes gastric cancer migration, invasion and proliferation by directly targeting transducer of ERBB2, 1 and correlates with poor survival. Oncogene. 2015 May 14;34(20):2556-65. | ||||
REF 22 | MiR-34a modulates ErbB2 in breast cancer. Cell Biol Int. 2017 Jan;41(1):93-101. | ||||
REF 23 | Tumor suppressor role of miR-3622b-5p in ERBB2-positive cancer. Oncotarget. 2017 Apr 4;8(14):23008-23019. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Wang and Dr. Li.