Target General Information
Target ID T14597 Target Info
Target Name Erbb2 tyrosine kinase receptor (HER2)
Synonyms p185erbB2; Tyrosine kinase-type cell surface receptor HER2; Receptor tyrosine-protein kinase erbB-2; Proto-oncogene c-ErbB-2; Proto-oncogene Neu; NGL; NEU; Metastatic lymph node gene 19 protein; MLN19; MLN 19; HER2; CD340
Target Type Successful Target
Gene Name ERBB2
Biochemical Class Kinase
UniProt ID
The microRNAs (miRNAs) Regulating This Target
miRNA Mature ID hsa-miR-331-3p miRNA Info
miRNA Mature AC
Sequence gccccugggccuauccuagaa
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-331-3p by mature miRNA precursor transfection resulted in the decreased protein level of target ERBB2. [2]
Evidence Score (E-score) 5 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay [3]
4 Luciferase Reporter Assay; Microarray; Western Blot [4]
5 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
Erbb2 tyrosine kinase receptor (HER2) Target Info
miRNA Mature ID hsa-miR-125a-5p miRNA Info
miRNA Mature AC
Sequence ucccugagacccuuuaaccuguga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-125a-5p by mature miRNA transfection resulted in the decreased protein level of target ERBB2. [2]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay [6]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
4 Western Blot; qRT-PCR [8]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
Apoptosis regulator Bcl-2 (BCL-2) Target Info
miRNA Mature ID hsa-miR-125b-5p miRNA Info
miRNA Mature AC
Sequence ucccugagacccuaacuuguga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-125b-5p by mature miRNA transfection resulted in the decreased protein level of target ERBB2. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [9]
2 Western Blot; Northern Blot; Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
Cyclin-dependent kinase 6 (CDK6) Target Info
miRNA Mature ID hsa-miR-193a-5p miRNA Info
miRNA Mature AC
Sequence ugggucuuugcgggcgagauga
miRNA Species Homo sapiens
Regulation Mechanism miR-193a-5p directly regulated HER2 by interacting with the 3-UTR. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [10]
2 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA AP-2 transcription factor (TFAP2A) Target Info
Erbb2 tyrosine kinase receptor (HER2) Target Info
miRNA Mature ID hsa-miR-205-5p miRNA Info
miRNA Mature AC
Sequence uccuucauuccaccggagucug
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of erbB2 induces anchorage-independent growth in breast epithelial cells due to the deduction of miR-205. [12]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [11]
2 qRT-PCR; Western Blot [12]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
Apoptosis regulator Bcl-2 (BCL-2) Target Info
miRNA Mature ID hsa-miR-559 miRNA Info
miRNA Mature AC
Sequence uaaaguaaauaugcaccaaaa
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [13]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Erbb2 tyrosine kinase receptor (HER2) Target Info
Metastasis associated gene-1 (MTA1) Target Info
miRNA Mature ID hsa-miR-1296-5p miRNA Info
miRNA Mature AC
Sequence uuagggcccuggcuccaucucc
miRNA Species Homo sapiens
Regulation Mechanism miR-1296-5p might be involved in the regulation on the migration and invasion of human gastric cancer cells at least in part via targeting ERBB2 signaling pathway. [15]
Evidence Score (E-score) 2 +
1 Dual Luciferase Reporter Assay; Western Blot [14]
2 Luciferase Reporter Assay; Western Blot [15]
Representative Target(s) Regulated by This miRNA Erbb2 tyrosine kinase receptor (HER2) Target Info
miRNA Mature ID hsa-miR-130b-3p miRNA Info
miRNA Mature AC
Sequence cagugcaaugaugaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism miR-130b-3p promotes TGF-b1-induced EMT in renal tubular epithelial cells by targeting ERBB2IP. [16]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [16]
Representative Target(s) Regulated by This miRNA Acyl-CoA desaturase (SCD) Target Info
Cyclin A2 (CCNA2) Target Info
miRNA Mature ID hsa-miR-134-5p miRNA Info
miRNA Mature AC
Sequence ugugacugguugaccagagggg
miRNA Species Homo sapiens
Regulation Mechanism miR-134 directly regulated HER2 by interacting with the 3-UTR. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Angiopoietin-related protein 4 (ANGPTL4) Target Info
Erbb2 tyrosine kinase receptor (HER2) Target Info
miRNA Mature ID hsa-miR-155-3p miRNA Info
miRNA Mature AC
Sequence cuccuacauauuagcauuaaca
miRNA Species Homo sapiens
Regulation Mechanism miR-155 directly targets ErbB2 via a regulatory element in its coding region. [17]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
Erbb2 tyrosine kinase receptor (HER2) Target Info
miRNA Mature ID hsa-miR-193a-3p miRNA Info
miRNA Mature AC
Sequence aacuggccuacaaagucccagu
miRNA Species Homo sapiens
Regulation Mechanism miR-193a-5p directly regulated HER2 by interacting with the 3-UTR. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
Erbb2 tyrosine kinase receptor (HER2) Target Info
miRNA Mature ID hsa-miR-199b-5p miRNA Info
miRNA Mature AC
Sequence cccaguguuuagacuaucuguuc
miRNA Species Homo sapiens
Regulation Mechanism miR-199b-5p direct targets HER2 in breast cancer cell. [18]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA Epithelial discoidin domain receptor 1 (DDR1) Target Info
Erbb2 tyrosine kinase receptor (HER2) Target Info
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [19]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
Apoptosis regulator Bcl-2 (BCL-2) Target Info
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Regulation Mechanism miR-22 can regulate ErbB2 by binding to the 3'UTR of ErbB2. [20]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [20]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
ATP-citrate synthase (ACLY) Target Info
miRNA Mature ID hsa-miR-25-3p miRNA Info
miRNA Mature AC
Sequence cauugcacuugucucggucuga
miRNA Species Homo sapiens
Regulation Mechanism miR-25 promotes gastric cancer progression by directly downregulating TOB1 expression. [21]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [21]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1C p57Kip2 (CDKN1C) Target Info
Cellular tumor antigen p53 (TP53) Target Info
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism A luciferase reporter assay was done to understand the potential correlation between ErbB2 and miR-34a. [22]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [22]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
Androgen receptor (AR) Target Info
miRNA Mature ID hsa-miR-3622b-5p miRNA Info
miRNA Mature AC
Sequence aggcaugggaggucagguga
miRNA Species Homo sapiens
Regulation Mechanism miR-3622b-5p is involved in the proliferation and apoptosis of human ERBB2-positive cancer cells via targeting ERBB2/mTORC1 signaling pathway. [23]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [23]
Representative Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Target Info
Erbb2 tyrosine kinase receptor (HER2) Target Info
miRNA Mature ID hsa-miR-541-3p miRNA Info
miRNA Mature AC
Sequence uggugggcacagaaucuggacu
miRNA Species Homo sapiens
Regulation Mechanism miR-541 directly regulated HER2 by interacting with the 3-UTR. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Erbb2 tyrosine kinase receptor (HER2) Target Info
Voltage-gated calcium channel alpha Cav2.3 (CACNA1E) Target Info
miRNA Mature ID hsa-miR-552-3p miRNA Info
miRNA Mature AC
Sequence aacaggugacugguuagacaa
miRNA Species Homo sapiens
Regulation Mechanism miR-552 directly regulated HER2 by interacting with the 3-UTR. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
Erbb2 tyrosine kinase receptor (HER2) Target Info
miRNA Mature ID hsa-miR-323b-5p miRNA Info
miRNA Mature AC
Sequence agguuguccguggugaguucgca
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Erbb2 tyrosine kinase receptor (HER2) Target Info
miRNA Mature ID hsa-miR-548d-3p miRNA Info
miRNA Mature AC
Sequence caaaaaccacaguuucuuuugc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Erbb2 tyrosine kinase receptor (HER2) Target Info
References
REF 1 Lnc RNA HOTAIR functions as a competing endogenous RNA to regulate HER2 expression by sponging miR-331-3p in gastric cancer. Mol Cancer. 2014 Apr 28;13:92.
REF 2 Coordinate suppression of ERBB2 and ERBB3 by enforced expression of micro-RNA miR-125a or miR-125b. J Biol Chem. 2007 Jan 12;282(2):1479-86.
REF 3 High-throughput screens identify microRNAs essential for HER2 positive breast cancer cell growth. Mol Oncol. 2014 Feb;8(1):93-104.
REF 4 Regulation of ErbB receptor signalling in cancer cells by microRNA. Curr Opin Pharmacol. 2010 Dec;10(6):655-61.
REF 5 MiR-331-3p inhibits proliferation and promotes apoptosis by targeting HER2 through the PI3K/Akt and ERK1/2 pathways in colorectal cancer. Oncol Rep. 2016 Feb;35(2):1075-82.
REF 6 MicroRNA-125a-5p is an independent prognostic factor in gastric cancer and inhibits the proliferation of human gastric cancer cells in combination with trastuzumab. Clin Cancer Res. 2011 May 1;17(9):2725-33.
REF 7 Chemotherapy-Regulated microRNA-125-HER2 Pathway as a Novel Therapeutic Target for Trastuzumab-Mediated Cellular Cytotoxicity in Small Cell Lung Cancer. Mol Cancer Ther. 2015 Jun;14(6):1414-23.
REF 8 Functional cooperation of miR-125a, miR-125b, and miR-205 in entinostat-induced downregulation of erbB2/erbB3 and apoptosis in breast cancer cells. Cell Death Dis. 2013 Mar 21;4:e556.
REF 9 MicroRNA-125b down-regulation mediates endometrial cancer invasion by targeting ERBB2. Med Sci Monit. 2012 Apr;18(4):BR149-55.
REF 10 MiR-193a-5p/ERBB2 act as concurrent chemoradiation therapy response indicator of esophageal squamous cell carcinoma. Oncotarget. 2016 Jun 28;7(26):39680-39693.
REF 11 miR-205-5p-mediated downregulation of ErbB/HER receptors in breast cancer stem cells results in targeted therapy resistance. Cell Death Dis. 2015 Jul 16;6:e1823.
REF 12 ErbB2 down-regulates microRNA-205 in breast cancer. Biochem Biophys Res Commun. 2011 Aug 12;411(4):804-8.
REF 13 Preliminary validation of ERBB2 expression regulated by miR-548d-3p and miR-559. Biochem Biophys Res Commun. 2009 Aug 7;385(4):596-600.
REF 14 miR-1296-5p decreases ERBB2 expression to inhibit the cell proliferation in ERBB2-positive breast cancer. Cancer Cell Int. 2017 Oct 24;17:95.
REF 15 miR 1296-5p Inhibits the Migration and Invasion of Gastric Cancer Cells by Repressing ERBB2 Expression. PLoS One. 2017 Jan 18;12(1):e0170298.
REF 16 Up-regulation of Serum MiR-130b-3p Level is Associated with Renal Damage in Early Lupus Nephritis. Sci Rep. 2015 Aug 28;5:12644.
REF 17 miR-155 downregulates ErbB2 and suppresses ErbB2-induced malignant transformation of breast epithelial cells. Oncogene. 2016 Nov 17;35(46):6015-6025.
REF 18 MiR-199b-5p targets HER2 in breast cancer cells. J Cell Biochem. 2013 Jul;114(7):1457-63.
REF 19 Up-regulation of miR-21 by HER2/neu signaling promotes cell invasion. J Biol Chem. 2009 Jul 3;284(27):18515-24.
REF 20 Dual Action of miR-125b As a Tumor Suppressor and OncomiR-22 Promotes Prostate Cancer Tumorigenesis. PLoS One. 2015 Nov 6;10(11):e0142373.
REF 21 MicroRNA-25 promotes gastric cancer migration, invasion and proliferation by directly targeting transducer of ERBB2, 1 and correlates with poor survival. Oncogene. 2015 May 14;34(20):2556-65.
REF 22 MiR-34a modulates ErbB2 in breast cancer. Cell Biol Int. 2017 Jan;41(1):93-101.
REF 23 Tumor suppressor role of miR-3622b-5p in ERBB2-positive cancer. Oncotarget. 2017 Apr 4;8(14):23008-23019.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Wang and Dr. Li.