Target Regulator(s) Information (MicroRNA)
Target General Information | |||||
---|---|---|---|---|---|
Target ID | T52450 | Target Info | |||
Target Name | Matrix metalloproteinase-1 (MMP-1) | ||||
Synonyms | Interstitial collagenase; Fibroblast collagenase; CLG | ||||
Target Type | Successful Target | ||||
Gene Name | MMP1 | ||||
Biochemical Class | Peptidase | ||||
UniProt ID | |||||
The microRNAs (miRNAs) Regulating This Target | |||||
miRNA Mature ID | hsa-miR-145-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | guccaguuuucccaggaaucccu | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 2 | + | |||
1 | qPCR | [1] | |||
2 | Reporter Assay | [2] | |||
Representative Target(s) Regulated by This miRNA | A proliferation-inducing ligand (APRIL) | Target Info | |||
Alkaline phosphatase (ALPPL2) | Target Info | ||||
miRNA Mature ID | hsa-miR-202-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | agagguauagggcaugggaa | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | Transfection with miR-202-3p mimics represses the luciferase activity of MMP1 3'UTR-WT, but has no influence on the mutants. | [3] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay | [3] | |||
2 | Luciferase Reporter Assay | [4] | |||
Representative Target(s) Regulated by This miRNA | B-cell-activating factor (TNFSF13B) | Target Info | |||
LDL receptor related protein-6 (LRP-6) | Target Info | ||||
miRNA Mature ID | hsa-miR-222-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | agcuacaucuggcuacugggu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | The overexpression of miR-222-3p by mature miRNA mimics tranfection resulted in the decreased protein level of target MMP1. | [5] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot | [5] | |||
2 | Western Blot | [6] | |||
Representative Target(s) Regulated by This miRNA | AN1-type zinc finger protein 5 (ZFAND5) | Target Info | |||
ATP-binding cassette transporter G2 (ABCG2) | Target Info | ||||
miRNA Mature ID | hsa-miR-203a-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | gugaaauguuuaggaccacuag | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | High expression of miR-203 in RASFs leads to increased secretion of MMP-1. | [7] | |||
Evidence Score (E-score) | 1 | + | |||
1 | ELISA | [7] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis inhibitor survivin (BIRC5) | Target Info | |||
Apoptosis regulator Bcl-W (BCL-W) | Target Info | ||||
miRNA Mature ID | hsa-miR-526b-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | gaaagugcuuccuuuuagaggc | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | Overexpression of miR-526b induced the reduced activity of MMP1 3'UTR luciferase. | [8] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [8] | |||
Representative Target(s) Regulated by This miRNA | Lysine N-methyltransferase 3A (SETD2) | Target Info | |||
Matrix metalloproteinase-1 (MMP-1) | Target Info | ||||
References | |||||
REF 1 | miRNA-145 targets v-ets erythroblastosis virus E26 oncogene homolog 1 to suppress the invasion, metastasis, and angiogenesis of gastric cancer cells. Mol Cancer Res. 2013 Feb;11(2):182-93. | ||||
REF 2 | miR-145, miR-133a and miR-133b: Tumor-suppressive miRNAs target FSCN1 in esophageal squamous cell carcinoma. Int J Cancer. 2010 Dec 15;127(12):2804-14. | ||||
REF 3 | MicroRNA-202-3p regulates scleroderma fibrosis by targeting matrix metalloproteinase 1. Biomed Pharmacother. 2017 Mar;87:412-418. | ||||
REF 4 | MiR-202-3p regulates interleukin-1beta-induced expression of matrix metalloproteinase 1 in human nucleus pulposus. Gene. 2019 Mar 1;687:156-165. | ||||
REF 5 | MicroRNA-222 regulates cell invasion by targeting matrix metalloproteinase 1 (MMP1) and manganese superoxide dismutase 2 (SOD2) in tongue squamous cell carcinoma cell lines. Cancer Genomics Proteomics. 2009 May-Jun;6(3):131-9. | ||||
REF 6 | Role of microRNA-mediated MMP regulation in the treatment and diagnosis of malignant tumors. Cancer Biol Ther. 2013 Sep;14(9):796-805. | ||||
REF 7 | Altered expression of microRNA-203 in rheumatoid arthritis synovial fibroblasts and its role in fibroblast activation. Arthritis Rheum. 2011 Feb;63(2):373-81. | ||||
REF 8 | miR-526b targets 3' UTR of MMP1 mRNA. Exp Mol Med. 2015 Aug 21;47:e178. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Wang and Dr. Li.