Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T52450 Target Info
Target Name Matrix metalloproteinase-1 (MMP-1)
Synonyms Interstitial collagenase; Fibroblast collagenase; CLG
Target Type Successful Target
Gene Name MMP1
Biochemical Class Peptidase
UniProt ID
P03956
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 qPCR [1]
2 Reporter Assay [2]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-202-3p miRNA Info
miRNA Mature AC
MIMAT0002811
Sequence agagguauagggcaugggaa
miRNA Species Homo sapiens
Regulation Mechanism Transfection with miR-202-3p mimics represses the luciferase activity of MMP1 3'UTR-WT, but has no influence on the mutants. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA B-cell-activating factor (TNFSF13B) Target Info
TN13B_HUMAN
LDL receptor related protein-6 (LRP-6) Target Info
LRP6_HUMAN
miRNA Mature ID hsa-miR-222-3p miRNA Info
miRNA Mature AC
MIMAT0000279
Sequence agcuacaucuggcuacugggu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-222-3p by mature miRNA mimics tranfection resulted in the decreased protein level of target MMP1. [5]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [5]
2 Western Blot [6]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Regulation Mechanism High expression of miR-203 in RASFs leads to increased secretion of MMP-1. [7]
Evidence Score (E-score) 1 +
1 ELISA [7]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-526b-3p miRNA Info
miRNA Mature AC
MIMAT0002836
Sequence gaaagugcuuccuuuuagaggc
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-526b induced the reduced activity of MMP1 3'UTR luciferase. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Lysine N-methyltransferase 3A (SETD2) Target Info
SETD2_HUMAN
Matrix metalloproteinase-1 (MMP-1) Target Info
MMP1_HUMAN
References  Top
REF 1 miRNA-145 targets v-ets erythroblastosis virus E26 oncogene homolog 1 to suppress the invasion, metastasis, and angiogenesis of gastric cancer cells. Mol Cancer Res. 2013 Feb;11(2):182-93.
REF 2 miR-145, miR-133a and miR-133b: Tumor-suppressive miRNAs target FSCN1 in esophageal squamous cell carcinoma. Int J Cancer. 2010 Dec 15;127(12):2804-14.
REF 3 MicroRNA-202-3p regulates scleroderma fibrosis by targeting matrix metalloproteinase 1. Biomed Pharmacother. 2017 Mar;87:412-418.
REF 4 MiR-202-3p regulates interleukin-1beta-induced expression of matrix metalloproteinase 1 in human nucleus pulposus. Gene. 2019 Mar 1;687:156-165.
REF 5 MicroRNA-222 regulates cell invasion by targeting matrix metalloproteinase 1 (MMP1) and manganese superoxide dismutase 2 (SOD2) in tongue squamous cell carcinoma cell lines. Cancer Genomics Proteomics. 2009 May-Jun;6(3):131-9.
REF 6 Role of microRNA-mediated MMP regulation in the treatment and diagnosis of malignant tumors. Cancer Biol Ther. 2013 Sep;14(9):796-805.
REF 7 Altered expression of microRNA-203 in rheumatoid arthritis synovial fibroblasts and its role in fibroblast activation. Arthritis Rheum. 2011 Feb;63(2):373-81.
REF 8 miR-526b targets 3' UTR of MMP1 mRNA. Exp Mol Med. 2015 Aug 21;47:e178.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.