Target General Information
Target ID T53524 Target Info
Target Name Platelet-derived growth factor receptor alpha (PDGFRA)
Synonyms RHEPDGFRA; Platelet-derived growth factor receptor 2; Platelet-derived growth factor alpha receptor; PDGFR2; PDGFR-alpha; PDGFR-2; PDGF-R-alpha; CD140a antigen; CD140a; CD140 antigen-like family member A; Alpha-type platelet-derived growth factor receptor; Alpha platelet-derived growth factor receptor
Target Type Successful Target
Gene Name PDGFRA
Biochemical Class Kinase
UniProt ID
The microRNAs (miRNAs) Regulating This Target
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Evidence Score (E-score) 4 +
1 In Situ Hybridization; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
Androgen receptor (AR) Target Info
miRNA Mature ID hsa-let-7b-5p miRNA Info
miRNA Mature AC
Sequence ugagguaguagguugugugguu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Microarray; qRT-PCR [5]
2 qRT-PCR [6]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
miRNA Mature ID hsa-miR-140-5p miRNA Info
miRNA Mature AC
Sequence cagugguuuuacccuaugguag
miRNA Species Homo sapiens
Regulation Mechanism Pdgfra was the target of microRNA-140 in MPMC. [8]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
2 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Adenosine deaminase (ADA) Target Info
Aspartyl aminopeptidase (DNPEP) Target Info
miRNA Mature ID hsa-miR-146b-5p miRNA Info
miRNA Mature AC
Sequence ugagaacugaauuccauaggcug
miRNA Species Homo sapiens
Regulation Mechanism Reporter assays in 293T cells revealed miRNA-dependent repression of this 3'UTR, and introduction of mutations to either one or both of the two miR-146b-binding sites abrogated this reduction in luciferase activity. [9]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Northern Blot; Western Blot [9]
2 Western Blot; RT-PCR [10]
Representative Target(s) Regulated by This miRNA Calgranulin D (S100A12) Target Info
DNA-binding factor KBF1 (p105) Target Info
miRNA Mature ID hsa-miR-34c-5p miRNA Info
miRNA Mature AC
Sequence aggcaguguaguuagcugauugc
miRNA Species Homo sapiens
Regulation Mechanism miR-34c targets PDGFR-A 3'UTR. [1]
Evidence Score (E-score) 2 +
1 In Situ Hybridization; Luciferase Reporter Assay; Western Blot [1]
2 Western Blot; RT-PCR [11]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
Cyclin-dependent kinase 4 (CDK4) Target Info
miRNA Mature ID hsa-miR-130a-3p miRNA Info
miRNA Mature AC
Sequence cagugcaauguuaaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism Luciferase activity of Luc-Pdgfra-3'UTR reporter constructs in the presence of miR-130a mimic and miR-130a antagomir. [12]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [12]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
Amyloid beta A4 protein (APP) Target Info
miRNA Mature ID hsa-miR-130b-3p miRNA Info
miRNA Mature AC
Sequence cagugcaaugaugaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism 3'UTR of PDGFRA is a target of miR-let-7b. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Acyl-CoA desaturase (SCD) Target Info
Cyclin A2 (CCNA2) Target Info
References
REF 1 MiR-34a/c-Dependent PDGFR-/ Downregulation Inhibits Tumorigenesis and Enhances TRAIL-Induced Apoptosis in Lung Cancer. PLoS One. 2013 Jun 21;8(6):e67581.
REF 2 miR-34a repression in proneural malignant gliomas upregulates expression of its target PDGFRA and promotes tumorigenesis. PLoS One. 2012;7(3):e33844.
REF 3 miRNA-34a promotes proliferation of human pulmonary artery smooth muscle cells by targeting PDGFRA. Cell Prolif. 2016 Aug;49(4):484-93.
REF 4 MicroRNA-34A inhibits the growth, invasion and metastasis of gastric cancer by targeting PDGFR and MET expression. Biosci Rep. 2014 Jun 25;34(3). pii: e00112.
REF 5 Fibroblast growth factor (FGF) signaling during gastrulation negatively modulates the abundance of microRNAs that regulate proteins required for cell migration and embryo patterning. J Biol Chem. 2012 Nov 9;287(46):38505-14.
REF 6 MicroRNA let-7a down-regulates MYC and reverts MYC-induced growth in Burkitt lymphoma cells. Cancer Res. 2007 Oct 15;67(20):9762-70.
REF 7 miR-140-5p inhibits ovarian cancer growth partially by repression of PDGFRA. Biomed Pharmacother. 2015 Oct;75:117-22.
REF 8 Biological and epidemiological evidence of interaction of infant genotypes at Rs7205289 and maternal passive smoking in cleft palate. Am J Med Genet A. 2011 Dec;155A(12):2940-8.
REF 9 The regulatory roles of microRNA-146b-5p and its target platelet-derived growth factor receptor (PDGFRA) in erythropoiesis and megakaryocytopoiesis. J Biol Chem. 2014 Aug 15;289(33):22600-13.
REF 10 miR-146b-5p promotes VSMC proliferation and migration. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12901-7.
REF 11 Differential Expression of miR-34c and Its Predicted Target Genes in Testicular Tissue at Different Development Stages of Swine. Asian-Australas J Anim Sci. 2015 Nov;28(11):1532-6.
REF 12 The Etv2-miR-130a Network Regulates Mesodermal Specification. Cell Rep. 2015 Nov 3;13(5):915-23.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Wang and Dr. Li.