Target Regulator(s) Information (MicroRNA)

Target General Information
Target ID	T59328		Target Info
Target Name	Epidermal growth factor receptor (EGFR)
Synonyms	Receptor tyrosine-protein kinase erbB-1; Proto-oncogene c-ErbB-1; HER1; ERBB1; ERBB
Target Type	Successful Target
Gene Name	EGFR
Biochemical Class	Kinase
UniProt ID	P00533
The microRNAs (miRNAs) Regulating This Target
miRNA Mature ID	hsa-miR-146a-5p		miRNA Info
miRNA Mature AC	MIMAT0000449
Sequence	ugagaacugaauuccauggguu
miRNA Species	Homo sapiens
Regulation Mechanism	Reexpression of miR-146a led to the inhibition of EGFR signaling in pancreatic cancer cells.		[6]
Evidence Score (E-score)	7		+
1	Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot		[1]
2	Luciferase Reporter Assay; qRT-PCR; Western Blot		[2]
3	Luciferase Reporter Assay; qRT-PCR; Western Blot		[3]
4	Luciferase Reporter Assay; Western Blot		[4]
5	qRT-PCR; Western Blot		[5]
6	Western Blot		[6]
7	Western Blot; qRT-PCR		[7]
Representative Target(s) Regulated by This miRNA	Activation B7-1 antigen (CD80)	Target Info	CD80_HUMAN
Representative Target(s) Regulated by This miRNA	Apoptosis mediating surface antigen FAS (FAS)	Target Info	TNR6_HUMAN
miRNA Mature ID	hsa-miR-133b		miRNA Info
miRNA Mature AC	MIMAT0000770
Sequence	uuugguccccuucaaccagcua
miRNA Species	Homo sapiens
Regulation Mechanism	EGFR was significantly lowered after transfection of miR-133b.		[10]
Evidence Score (E-score)	3		+
1	In Situ Hybridization; Luciferase Reporter Assay; qRT-PCR; Western Blot		[8]
2	Luciferase Reporter Assay; Western Blot		[9]
3	Luciferase Reporter Assay; Western Blot		[10]
Representative Target(s) Regulated by This miRNA	Apoptosis mediating surface antigen FAS (FAS)	Target Info	TNR6_HUMAN
Representative Target(s) Regulated by This miRNA	Apoptosis regulator Bcl-W (BCL-W)	Target Info	B2CL2_HUMAN
miRNA Mature ID	hsa-miR-125a-5p		miRNA Info
miRNA Mature AC	MIMAT0000443
Sequence	ucccugagacccuuuaaccuguga
miRNA Species	Homo sapiens
Regulation Mechanism	miR-125a regulates cell cycle, proliferation, and apoptosis by targeting the ErbB pathway in acute myeloid leukemia.		[11]
Evidence Score (E-score)	2		+
1	qRT-PCR; Western Blot		[11]
2	Western Blot; RT-PCR		[12]
Representative Target(s) Regulated by This miRNA	Apoptosis regulator BAK (BAK)	Target Info	BAK_HUMAN
Representative Target(s) Regulated by This miRNA	Apoptosis regulator Bcl-2 (BCL-2)	Target Info	BCL2_HUMAN
miRNA Mature ID	hsa-miR-200a-3p		miRNA Info
miRNA Mature AC	MIMAT0000682
Sequence	uaacacugucugguaacgaugu
miRNA Species	Homo sapiens
Regulation Mechanism	Wild-type (WT) and mutated (Mut) of EGFR 3'UTR Luciferase reporters were stably co-transfected with miR-200a or its scramble vector, and the stable transfectants were used to evaluate for their reporter activity.		[14]
Evidence Score (E-score)	2		+
1	Luciferase Reporter Assay; RT-PCR; Western Blot		[13]
2	Western Blot		[14]
Representative Target(s) Regulated by This miRNA	Amphiregulin (AREG)	Target Info	AREG_HUMAN
Representative Target(s) Regulated by This miRNA	Beta-catenin (CTNNB1)	Target Info	CTNB1_HUMAN
miRNA Mature ID	hsa-miR-21-5p		miRNA Info
miRNA Mature AC	MIMAT0000076
Sequence	uagcuuaucagacugauguuga
miRNA Species	Homo sapiens
Evidence Score (E-score)	2		+
1	Luciferase Reporter Assay; Microarray; Western Blot		[15]
2	Western Blot		[16]
Representative Target(s) Regulated by This miRNA	Apoptosis antigen ligand (CD178)	Target Info	TNFL6_HUMAN
Representative Target(s) Regulated by This miRNA	Apoptosis regulator Bcl-2 (BCL-2)	Target Info	BCL2_HUMAN
miRNA Mature ID	hsa-miR-27a-3p		miRNA Info
miRNA Mature AC	MIMAT0000084
Sequence	uucacaguggcuaaguuccgc
miRNA Species	Homo sapiens
Regulation Mechanism	miR-27a is targeted to the region 1 of EGFR 3-UTR.		[17]
Evidence Score (E-score)	2		+
1	Luciferase Reporter Assay		[17]
2	Luciferase Reporter Assay; qRT-PCR; Western Blot		[18]
Representative Target(s) Regulated by This miRNA	ATP-binding cassette transporter A1 (ABCA1)	Target Info	ABCA1_HUMAN
Representative Target(s) Regulated by This miRNA	Cellular tumor antigen p53 (TP53)	Target Info	P53_HUMAN
miRNA Mature ID	hsa-miR-302b-3p		miRNA Info
miRNA Mature AC	MIMAT0000715
Sequence	uaagugcuuccauguuuuaguag
miRNA Species	Homo sapiens
Regulation Mechanism	Re-expression of miR-302b did not affect the mRNA expression of EGFR, but could suppress EGFR at the protein level.		[19]
Evidence Score (E-score)	2		+
1	Luciferase Reporter Assay; Western Blot		[19]
2	Western Blot		[20]
Representative Target(s) Regulated by This miRNA	Cyclin-dependent kinase 2 (CDK2)	Target Info	CDK2_HUMAN
Representative Target(s) Regulated by This miRNA	Dihydrothymine dehydrogenase (DPYD)	Target Info	DPYD_HUMAN
miRNA Mature ID	hsa-miR-491-5p		miRNA Info
miRNA Mature AC	MIMAT0002807
Sequence	aguggggaacccuuccaugagg
miRNA Species	Homo sapiens
Regulation Mechanism	miR-491-5p regulates EGFR by directly targeting its 3'UTR.		[21]
Evidence Score (E-score)	2		+
1	Luciferase Reporter Assay		[21]
2	Luciferase Reporter Assay; qRT-PCR; Western Blot		[22]
Representative Target(s) Regulated by This miRNA	Apoptosis regulator Bcl-xL (BCL-xL)	Target Info	B2CL1_HUMAN
Representative Target(s) Regulated by This miRNA	Cellular tumor antigen p53 (TP53)	Target Info	P53_HUMAN
miRNA Mature ID	hsa-miR-7-5p		miRNA Info
miRNA Mature AC	MIMAT0000252
Sequence	uggaagacuagugauuuuguugu
miRNA Species	Homo sapiens
Regulation Mechanism	The overexpression of miR-7-5p by mature miRNA precursor transfection resulted in the decreased protein level of target EGFR.		[24]
Evidence Score (E-score)	2		+
1	Western Blot; qRT-PCR		[23]
2	Western Blot; qRT-PCR; Luciferase Reporter Assay		[24]
Representative Target(s) Regulated by This miRNA	Activated CDC42 kinase 1 (ACK-1)	Target Info	ACK1_HUMAN
Representative Target(s) Regulated by This miRNA	Epidermal growth factor receptor (EGFR)	Target Info	EGFR_HUMAN
miRNA Mature ID	hsa-miR-542-5p		miRNA Info
miRNA Mature AC	MIMAT0003340
Sequence	ucggggaucaucaugucacgaga
miRNA Species	Homo sapiens
Regulation Mechanism	miR-542-5p directly targets EGFR in lung cancer cell lines.		[25]
Evidence Score (E-score)	2		+
1	Luciferase Reporter Assay; Western Blot		[25]
2	Western Blot; RT-PCR; Immunohistochemistry		[25]
Representative Target(s) Regulated by This miRNA	Epidermal growth factor receptor (EGFR)	Target Info	EGFR_HUMAN
miRNA Mature ID	hsa-miR-875-5p		miRNA Info
miRNA Mature AC	MIMAT0004922
Sequence	uauaccucaguuuuaucaggug
miRNA Species	Homo sapiens
Regulation Mechanism	Oncogene EGFR was revealed to be a target of miR-875-5p, which was inversely correlated with miR-875-5p expression in CRC.		[27]
Evidence Score (E-score)	2		+
1	Immunofluorescence; Luciferase Reporter Assay; qRT-PCR; Western Blot		[26]
2	Luciferase Reporter Assay; Western Blot		[27]
Representative Target(s) Regulated by This miRNA	Epidermal growth factor receptor (EGFR)	Target Info	EGFR_HUMAN
miRNA Mature ID	hsa-miR-122-5p		miRNA Info
miRNA Mature AC	MIMAT0000421
Sequence	uggagugugacaaugguguuug
miRNA Species	Homo sapiens
Regulation Mechanism	The miR-122a significantly decreased the relative luciferase activity in the WT 3'TR of EGFR.		[28]
Evidence Score (E-score)	1		+
1	Luciferase Reporter Assay; Western Blot		[28]
Representative Target(s) Regulated by This miRNA	Apoptosis regulator Bcl-W (BCL-W)	Target Info	B2CL2_HUMAN
Representative Target(s) Regulated by This miRNA	Apoptosis regulator Bcl-xL (BCL-xL)	Target Info	B2CL1_HUMAN
miRNA Mature ID	hsa-miR-132-3p		miRNA Info
miRNA Mature AC	MIMAT0000426
Sequence	uaacagucuacagccauggucg
miRNA Species	Homo sapiens
Regulation Mechanism	miR-7 can regulates EGFR gene by binding to the 3'UTR.		[29]
Evidence Score (E-score)	1		+
1	Immunohistochemistry; Luciferase Reporter Assay; Western Blot		[29]
Representative Target(s) Regulated by This miRNA	Brain-derived neurotrophic factor (BDNF)	Target Info	BDNF_HUMAN
Representative Target(s) Regulated by This miRNA	Cyclin A2 (CCNA2)	Target Info	CCNA2_HUMAN
miRNA Mature ID	hsa-miR-145-5p		miRNA Info
miRNA Mature AC	MIMAT0000437
Sequence	guccaguuuucccaggaaucccu
miRNA Species	Homo sapiens
Regulation Mechanism	hsa-miR-145 either directly or indirectly suppresses EGFR transcript levels.		[30]
Evidence Score (E-score)	1		+
1	Western Blot		[30]
Representative Target(s) Regulated by This miRNA	A proliferation-inducing ligand (APRIL)	Target Info	TNF13_HUMAN
Representative Target(s) Regulated by This miRNA	Alkaline phosphatase (ALPPL2)	Target Info	PPBN_HUMAN
miRNA Mature ID	hsa-miR-146b-5p		miRNA Info
miRNA Mature AC	MIMAT0002809
Sequence	ugagaacugaauuccauaggcug
miRNA Species	Homo sapiens
Regulation Mechanism	The activity of a luciferase reporter gene linked to the wild-type EGFR 3'UTR fragment decreased in response to transfection with miR-146-5p mimics.		[31]
Evidence Score (E-score)	1		+
1	Luciferase Reporter Assay; Western Blot		[31]
Representative Target(s) Regulated by This miRNA	Calgranulin D (S100A12)	Target Info	S10AC_HUMAN
Representative Target(s) Regulated by This miRNA	DNA-binding factor KBF1 (p105)	Target Info	NFKB1_HUMAN
miRNA Mature ID	hsa-miR-27a-5p		miRNA Info
miRNA Mature AC	MIMAT0004501
Sequence	agggcuuagcugcuugugagca
miRNA Species	Homo sapiens
Regulation Mechanism	Epidermal growth factor receptor (EGFR) was a target gene of miR-27a.		[32]
Evidence Score (E-score)	1		+
1	Western Blot		[32]
Representative Target(s) Regulated by This miRNA	Epidermal growth factor receptor (EGFR)	Target Info	EGFR_HUMAN
Representative Target(s) Regulated by This miRNA	Gremlin-1 (Gremlin-1)	Target Info	GREM1_HUMAN
miRNA Mature ID	hsa-miR-27b-3p		miRNA Info
miRNA Mature AC	MIMAT0000419
Sequence	uucacaguggcuaaguucugc
miRNA Species	Homo sapiens
Regulation Mechanism	EGFR was significantly reduced by transfection of miR-27b with the wild-type vector carrying the 3'UTR of EGFR.		[33]
Evidence Score (E-score)	1		+
1	Luciferase Reporter Assay; Western Blot		[33]
Representative Target(s) Regulated by This miRNA	Adenosine A2b receptor (ADORA2B)	Target Info	AA2BR_HUMAN
Representative Target(s) Regulated by This miRNA	Albendazole monooxygenase (CYP3A4)	Target Info	CP3A4_HUMAN
miRNA Mature ID	hsa-miR-574-3p		miRNA Info
miRNA Mature AC	MIMAT0003239
Sequence	cacgcucaugcacacacccaca
miRNA Species	Homo sapiens
Regulation Mechanism	miR-574-3p decreased the relative luciferase activities of EGFR.		[34]
Evidence Score (E-score)	1		+
1	Luciferase Reporter Assay; Western Blot		[34]
Representative Target(s) Regulated by This miRNA	Epidermal growth factor receptor (EGFR)	Target Info	EGFR_HUMAN
Representative Target(s) Regulated by This miRNA	Histone acetyltransferase p300 (EP300)	Target Info	EP300_HUMAN
miRNA Mature ID	hsa-miR-2861		miRNA Info
miRNA Mature AC	MIMAT0013802
Sequence	ggggccuggcggugggcgg
miRNA Species	Homo sapiens
Evidence Score (E-score)	1		+
1	Luciferase Reporter Assay; Western Blot		[35]
Representative Target(s) Regulated by This miRNA	Epidermal growth factor receptor (EGFR)	Target Info	EGFR_HUMAN
Representative Target(s) Regulated by This miRNA	G1/S-specific cyclin-D1 (CCND1)	Target Info	CCND1_HUMAN
miRNA Mature ID	hsa-miR-3622b-5p		miRNA Info
miRNA Mature AC	MIMAT0018005
Sequence	aggcaugggaggucagguga
miRNA Species	Homo sapiens
Regulation Mechanism	miR-3622b directly represses Epidermal Growth Factor Receptor (EGFR).		[36]
Evidence Score (E-score)	1		+
1	Luciferase Reporter Assay		[36]
Representative Target(s) Regulated by This miRNA	Epidermal growth factor receptor (EGFR)	Target Info	EGFR_HUMAN
Representative Target(s) Regulated by This miRNA	Erbb2 tyrosine kinase receptor (HER2)	Target Info	ERBB2_HUMAN
miRNA Mature ID	hsa-miR-7-1-3p		miRNA Info
miRNA Mature AC	MIMAT0004553
Sequence	caacaaaucacagucugccaua
miRNA Species	Homo sapiens
Regulation Mechanism	Introduction of miR-7 mimics could markedly decrease the expressions of EGFR.		[37]
Evidence Score (E-score)	1		+
1	Western Blot		[37]
Representative Target(s) Regulated by This miRNA	Epidermal growth factor receptor (EGFR)	Target Info	EGFR_HUMAN
Representative Target(s) Regulated by This miRNA	Insulin-like growth factor I receptor (IGF1R)	Target Info	IGF1R_HUMAN
References
REF 1	Down-regulation of microRNA-146a is associated with high-risk human papillomavirus infection and epidermal growth factor receptor overexpression in penile squamous cell carcinoma. Hum Pathol. 2017 Mar;61:33-40.
REF 2	Deregulation of miR-146a expression in a mouse model of pancreatic cancer affecting EGFR signaling. Cancer Lett. 2014 Aug 28;351(1):134-42.
REF 3	MiR-146a suppresses tumor growth and progression by targeting EGFR pathway and in a p-ERK-dependent manner in castration-resistant prostate cancer. Prostate. 2012 Aug 1;72(11):1171-8.
REF 4	Clinical significance of miR-146a in gastric cancer cases. Clin Cancer Res. 2011 Jul 1;17(13):4277-84.
REF 5	miR-146a suppresses invasion of pancreatic cancer cells. Cancer Res. 2010 Feb 15;70(4):1486-95.
REF 6	Breast cancer metastasis suppressor 1 up-regulates miR-146, which suppresses breast cancer metastasis. Cancer Res. 2009 Feb 15;69(4):1279-83.
REF 7	miR-146a inhibits cell growth, cell migration and induces apoptosis in non-small cell lung cancer cells. PLoS One. 2013;8(3):e60317.
REF 8	MicroRNA-133b inhibits the growth of non-small-cell lung cancer by targeting the epidermal growth factor receptor. FEBS J. 2012 Oct;279(20):3800-12.
REF 9	MicroRNA-133b inhibits proliferation and invasion of ovarian cancer cells through Akt and Erk1/2 inactivation by targeting epidermal growth factor ... Int J Clin Exp Pathol. 2015 Sep 1;8(9):10605-14.
REF 10	microRNA-133 inhibits cell proliferation, migration and invasion in prostate cancer cells by targeting the epidermal growth factor receptor. Oncol Rep. 2012 Jun;27(6):1967-75.
REF 11	miR-125a regulates cell cycle, proliferation, and apoptosis by targeting the ErbB pathway in acute myeloid leukemia. Leuk Res. 2014 Mar;38(3):402-10.
REF 12	Epidermal growth factor receptor-regulated miR-125a-5p--a metastatic inhibitor of lung cancer. FEBS J. 2009 Oct;276(19):5571-8.
REF 13	MicroRNA-200a Targets EGFR and c-Met to Inhibit Migration, Invasion, and Gefitinib Resistance in Non-Small Cell Lung Cancer. Cytogenet Genome Res. 2015;146(1):1-8.
REF 14	XIAP BIR domain suppresses miR-200a expression and subsequently promotes EGFR protein translation and anchorage-independent growth of bladder cancer cell. J Hematol Oncol. 2017 Jan 5;10(1):6.
REF 15	Regulation of ErbB receptor signalling in cancer cells by microRNA. Curr Opin Pharmacol. 2010 Dec;10(6):655-61.
REF 16	Downregulation of miR-21 inhibits EGFR pathway and suppresses the growth of human glioblastoma cells independent of PTEN status. Lab Invest. 2010 Feb;90(2):144-55.
REF 17	Mutant p53-R273H gains new function in sustained activation of EGFR signaling via suppressing miR-27a expression. Cell Death Dis. 2013 Apr 4;4:e574.
REF 18	Cross-talk between MET and EGFR in non-small cell lung cancer involves miR-27a and Sprouty2. Proc Natl Acad Sci U S A. 2013 May 21;110(21):8573-8.
REF 19	MicroRNA-302b suppresses cell proliferation by targeting EGFR in human hepatocellular carcinoma SMMC-7721 cells. BMC Cancer. 2013 Oct 2;13:448.
REF 20	The miR-302/367 cluster: a comprehensive update on its evolution and functions. Open Biol. 2015 Dec;5(12):150138.
REF 21	Two mature products of MIR-491 coordinate to suppress key cancer hallmarks in glioblastoma. Oncogene. 2015 Mar 26;34(13):1619-1628.
REF 22	Ginsenoside Rh2 Targets EGFR by Up-Regulation of miR-491 to Enhance Anti-tumor Activity in Hepatitis B Virus-Related Hepatocellular Carcinoma. Cell Biochem Biophys. 2015 Jun;72(2):325-31.
REF 23	EGFR promotes lung tumorigenesis by activating miR-7 through a Ras/ERK/Myc pathway that targets the Ets2 transcriptional repressor ERF. Cancer Res. 2010 Nov 1;70(21):8822-31.
REF 24	microRNA-7 inhibits the epidermal growth factor receptor and the Akt pathway and is down-regulated in glioblastoma. Cancer Res. 2008 May 15;68(10):3566-72.
REF 25	Isolation of miRNAs that target EGFR mRNA in human lung cancer. Biochem Biophys Res Commun. 2012 Apr 6;420(2):411-6.
REF 26	miR-875-5p counteracts epithelial-to-mesenchymal transition and enhances radiation response in prostate cancer through repression of the EGFR-ZEB1 axis. Cancer Lett. 2017 Jun 1;395:53-62.
REF 27	Hsa-miR-875-5p exerts tumor suppressor function through down-regulation of EGFR in colorectal carcinoma (CRC). Oncotarget. 2016 Jul 5;7(27):42225-42240.
REF 28	MicroRNA-122a Regulates Zonulin by Targeting EGFR in Intestinal Epithelial Dysfunction. Cell Physiol Biochem. 2017;42(2):848-858.
REF 29	MicroRNA-7 as a tumor suppressor and novel therapeutic for adrenocortical carcinoma. Oncotarget. 2015 Nov 3;6(34):36675-88.
REF 30	MiR-145 inhibits cell proliferation of human lung adenocarcinoma by targeting EGFR and NUDT1. RNA Biol. 2011 Jan-Feb;8(1):125-31.
REF 31	MicroRNA-146b-5p inhibits the growth of gallbladder carcinoma by targeting epidermal growth factor receptor. Mol Med Rep. 2015 Jul;12(1):1549-55.
REF 32	MicroRNA-27a functions as a tumor suppressor in renal cell carcinoma by targeting epidermal growth factor receptor. Oncol Lett. 2016 Jun;11(6):4217-4223.
REF 33	Dual regulation of receptor tyrosine kinase genes EGFR and c-Met by the tumor-suppressive microRNA-23b/27b cluster in bladder cancer. Int J Oncol. 2015 Feb;46(2):487-96.
REF 34	Genistein up-regulates tumor suppressor microRNA-574-3p in prostate cancer. PLoS One. 2013;8(3):e58929.
REF 35	miR-2861 acts as a tumor suppressor via targeting EGFR/AKT2/CCND1 pathway in cervical cancer induced by human papillomavirus virus 16 E6. Sci Rep. 2016 Jul 1;6:28968.
REF 36	Novel tumor suppressor microRNA at frequently deleted chromosomal region 8p21 regulates epidermal growth factor receptor in prostate cancer. Oncotarget. 2016 Oct 25;7(43):70388-70403.
REF 37	miR-7 reverses the resistance to BRAFi in melanoma by targeting EGFR/IGF-1R/CRAF and inhibiting the MAPK and PI3K/AKT signaling pathways. Oncotarget. 2016 Aug 16;7(33):53558-53570.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Wang and Dr. Li.

Prof. Feng ZHU

Prof. Yuzong CHEN