Target Regulator(s) Information (MicroRNA)
Target General Information | |||||
---|---|---|---|---|---|
Target ID | T59328 | Target Info | |||
Target Name | Epidermal growth factor receptor (EGFR) | ||||
Synonyms | Receptor tyrosine-protein kinase erbB-1; Proto-oncogene c-ErbB-1; HER1; ERBB1; ERBB | ||||
Target Type | Successful Target | ||||
Gene Name | EGFR | ||||
Biochemical Class | Kinase | ||||
UniProt ID | |||||
The microRNAs (miRNAs) Regulating This Target | |||||
miRNA Mature ID | hsa-miR-146a-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | ugagaacugaauuccauggguu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | Reexpression of miR-146a led to the inhibition of EGFR signaling in pancreatic cancer cells. | [6] | |||
Evidence Score (E-score) | 7 | + | |||
1 | Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot | [1] | |||
2 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [2] | |||
3 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [3] | |||
4 | Luciferase Reporter Assay; Western Blot | [4] | |||
5 | qRT-PCR; Western Blot | [5] | |||
6 | Western Blot | [6] | |||
7 | Western Blot; qRT-PCR | [7] | |||
Representative Target(s) Regulated by This miRNA | Activation B7-1 antigen (CD80) | Target Info | |||
Apoptosis mediating surface antigen FAS (FAS) | Target Info | ||||
miRNA Mature ID | hsa-miR-133b | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uuugguccccuucaaccagcua | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | EGFR was significantly lowered after transfection of miR-133b. | [10] | |||
Evidence Score (E-score) | 3 | + | |||
1 | In Situ Hybridization; Luciferase Reporter Assay; qRT-PCR; Western Blot | [8] | |||
2 | Luciferase Reporter Assay; Western Blot | [9] | |||
3 | Luciferase Reporter Assay; Western Blot | [10] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis mediating surface antigen FAS (FAS) | Target Info | |||
Apoptosis regulator Bcl-W (BCL-W) | Target Info | ||||
miRNA Mature ID | hsa-miR-125a-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | ucccugagacccuuuaaccuguga | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-125a regulates cell cycle, proliferation, and apoptosis by targeting the ErbB pathway in acute myeloid leukemia. | [11] | |||
Evidence Score (E-score) | 2 | + | |||
1 | qRT-PCR; Western Blot | [11] | |||
2 | Western Blot; RT-PCR | [12] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis regulator BAK (BAK) | Target Info | |||
Apoptosis regulator Bcl-2 (BCL-2) | Target Info | ||||
miRNA Mature ID | hsa-miR-200a-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uaacacugucugguaacgaugu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | Wild-type (WT) and mutated (Mut) of EGFR 3'UTR Luciferase reporters were stably co-transfected with miR-200a or its scramble vector, and the stable transfectants were used to evaluate for their reporter activity. | [14] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay; RT-PCR; Western Blot | [13] | |||
2 | Western Blot | [14] | |||
Representative Target(s) Regulated by This miRNA | Amphiregulin (AREG) | Target Info | |||
Beta-catenin (CTNNB1) | Target Info | ||||
miRNA Mature ID | hsa-miR-21-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uagcuuaucagacugauguuga | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay; Microarray; Western Blot | [15] | |||
2 | Western Blot | [16] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis antigen ligand (CD178) | Target Info | |||
Apoptosis regulator Bcl-2 (BCL-2) | Target Info | ||||
miRNA Mature ID | hsa-miR-27a-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uucacaguggcuaaguuccgc | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-27a is targeted to the region 1 of EGFR 3-UTR. | [17] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay | [17] | |||
2 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [18] | |||
Representative Target(s) Regulated by This miRNA | ATP-binding cassette transporter A1 (ABCA1) | Target Info | |||
Cellular tumor antigen p53 (TP53) | Target Info | ||||
miRNA Mature ID | hsa-miR-302b-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uaagugcuuccauguuuuaguag | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | Re-expression of miR-302b did not affect the mRNA expression of EGFR, but could suppress EGFR at the protein level. | [19] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [19] | |||
2 | Western Blot | [20] | |||
Representative Target(s) Regulated by This miRNA | Cyclin-dependent kinase 2 (CDK2) | Target Info | |||
Dihydrothymine dehydrogenase (DPYD) | Target Info | ||||
miRNA Mature ID | hsa-miR-491-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aguggggaacccuuccaugagg | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-491-5p regulates EGFR by directly targeting its 3'UTR. | [21] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay | [21] | |||
2 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [22] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-xL (BCL-xL) | Target Info | |||
Cellular tumor antigen p53 (TP53) | Target Info | ||||
miRNA Mature ID | hsa-miR-7-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uggaagacuagugauuuuguugu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | The overexpression of miR-7-5p by mature miRNA precursor transfection resulted in the decreased protein level of target EGFR. | [24] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Western Blot; qRT-PCR | [23] | |||
2 | Western Blot; qRT-PCR; Luciferase Reporter Assay | [24] | |||
Representative Target(s) Regulated by This miRNA | Activated CDC42 kinase 1 (ACK-1) | Target Info | |||
Epidermal growth factor receptor (EGFR) | Target Info | ||||
miRNA Mature ID | hsa-miR-542-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | ucggggaucaucaugucacgaga | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-542-5p directly targets EGFR in lung cancer cell lines. | [25] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [25] | |||
2 | Western Blot; RT-PCR; Immunohistochemistry | [25] | |||
Representative Target(s) Regulated by This miRNA | Epidermal growth factor receptor (EGFR) | Target Info | |||
miRNA Mature ID | hsa-miR-875-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uauaccucaguuuuaucaggug | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | Oncogene EGFR was revealed to be a target of miR-875-5p, which was inversely correlated with miR-875-5p expression in CRC. | [27] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Immunofluorescence; Luciferase Reporter Assay; qRT-PCR; Western Blot | [26] | |||
2 | Luciferase Reporter Assay; Western Blot | [27] | |||
Representative Target(s) Regulated by This miRNA | Epidermal growth factor receptor (EGFR) | Target Info | |||
miRNA Mature ID | hsa-miR-122-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uggagugugacaaugguguuug | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | The miR-122a significantly decreased the relative luciferase activity in the WT 3'TR of EGFR. | [28] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [28] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-W (BCL-W) | Target Info | |||
Apoptosis regulator Bcl-xL (BCL-xL) | Target Info | ||||
miRNA Mature ID | hsa-miR-132-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uaacagucuacagccauggucg | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-7 can regulates EGFR gene by binding to the 3'UTR. | [29] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Immunohistochemistry; Luciferase Reporter Assay; Western Blot | [29] | |||
Representative Target(s) Regulated by This miRNA | Brain-derived neurotrophic factor (BDNF) | Target Info | |||
Cyclin A2 (CCNA2) | Target Info | ||||
miRNA Mature ID | hsa-miR-145-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | guccaguuuucccaggaaucccu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | hsa-miR-145 either directly or indirectly suppresses EGFR transcript levels. | [30] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Western Blot | [30] | |||
Representative Target(s) Regulated by This miRNA | A proliferation-inducing ligand (APRIL) | Target Info | |||
Alkaline phosphatase (ALPPL2) | Target Info | ||||
miRNA Mature ID | hsa-miR-146b-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | ugagaacugaauuccauaggcug | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | The activity of a luciferase reporter gene linked to the wild-type EGFR 3'UTR fragment decreased in response to transfection with miR-146-5p mimics. | [31] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [31] | |||
Representative Target(s) Regulated by This miRNA | Calgranulin D (S100A12) | Target Info | |||
DNA-binding factor KBF1 (p105) | Target Info | ||||
miRNA Mature ID | hsa-miR-27a-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | agggcuuagcugcuugugagca | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | Epidermal growth factor receptor (EGFR) was a target gene of miR-27a. | [32] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Western Blot | [32] | |||
Representative Target(s) Regulated by This miRNA | Epidermal growth factor receptor (EGFR) | Target Info | |||
Gremlin-1 (Gremlin-1) | Target Info | ||||
miRNA Mature ID | hsa-miR-27b-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uucacaguggcuaaguucugc | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | EGFR was significantly reduced by transfection of miR-27b with the wild-type vector carrying the 3'UTR of EGFR. | [33] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [33] | |||
Representative Target(s) Regulated by This miRNA | Adenosine A2b receptor (ADORA2B) | Target Info | |||
Albendazole monooxygenase (CYP3A4) | Target Info | ||||
miRNA Mature ID | hsa-miR-574-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | cacgcucaugcacacacccaca | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-574-3p decreased the relative luciferase activities of EGFR. | [34] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [34] | |||
Representative Target(s) Regulated by This miRNA | Epidermal growth factor receptor (EGFR) | Target Info | |||
Histone acetyltransferase p300 (EP300) | Target Info | ||||
miRNA Mature ID | hsa-miR-2861 | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | ggggccuggcggugggcgg | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [35] | |||
Representative Target(s) Regulated by This miRNA | Epidermal growth factor receptor (EGFR) | Target Info | |||
G1/S-specific cyclin-D1 (CCND1) | Target Info | ||||
miRNA Mature ID | hsa-miR-3622b-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aggcaugggaggucagguga | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-3622b directly represses Epidermal Growth Factor Receptor (EGFR). | [36] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay | [36] | |||
Representative Target(s) Regulated by This miRNA | Epidermal growth factor receptor (EGFR) | Target Info | |||
Erbb2 tyrosine kinase receptor (HER2) | Target Info | ||||
miRNA Mature ID | hsa-miR-7-1-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | caacaaaucacagucugccaua | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | Introduction of miR-7 mimics could markedly decrease the expressions of EGFR. | [37] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Western Blot | [37] | |||
Representative Target(s) Regulated by This miRNA | Epidermal growth factor receptor (EGFR) | Target Info | |||
Insulin-like growth factor I receptor (IGF1R) | Target Info | ||||
References | |||||
REF 1 | Down-regulation of microRNA-146a is associated with high-risk human papillomavirus infection and epidermal growth factor receptor overexpression in penile squamous cell carcinoma. Hum Pathol. 2017 Mar;61:33-40. | ||||
REF 2 | Deregulation of miR-146a expression in a mouse model of pancreatic cancer affecting EGFR signaling. Cancer Lett. 2014 Aug 28;351(1):134-42. | ||||
REF 3 | MiR-146a suppresses tumor growth and progression by targeting EGFR pathway and in a p-ERK-dependent manner in castration-resistant prostate cancer. Prostate. 2012 Aug 1;72(11):1171-8. | ||||
REF 4 | Clinical significance of miR-146a in gastric cancer cases. Clin Cancer Res. 2011 Jul 1;17(13):4277-84. | ||||
REF 5 | miR-146a suppresses invasion of pancreatic cancer cells. Cancer Res. 2010 Feb 15;70(4):1486-95. | ||||
REF 6 | Breast cancer metastasis suppressor 1 up-regulates miR-146, which suppresses breast cancer metastasis. Cancer Res. 2009 Feb 15;69(4):1279-83. | ||||
REF 7 | miR-146a inhibits cell growth, cell migration and induces apoptosis in non-small cell lung cancer cells. PLoS One. 2013;8(3):e60317. | ||||
REF 8 | MicroRNA-133b inhibits the growth of non-small-cell lung cancer by targeting the epidermal growth factor receptor. FEBS J. 2012 Oct;279(20):3800-12. | ||||
REF 9 | MicroRNA-133b inhibits proliferation and invasion of ovarian cancer cells through Akt and Erk1/2 inactivation by targeting epidermal growth factor ... Int J Clin Exp Pathol. 2015 Sep 1;8(9):10605-14. | ||||
REF 10 | microRNA-133 inhibits cell proliferation, migration and invasion in prostate cancer cells by targeting the epidermal growth factor receptor. Oncol Rep. 2012 Jun;27(6):1967-75. | ||||
REF 11 | miR-125a regulates cell cycle, proliferation, and apoptosis by targeting the ErbB pathway in acute myeloid leukemia. Leuk Res. 2014 Mar;38(3):402-10. | ||||
REF 12 | Epidermal growth factor receptor-regulated miR-125a-5p--a metastatic inhibitor of lung cancer. FEBS J. 2009 Oct;276(19):5571-8. | ||||
REF 13 | MicroRNA-200a Targets EGFR and c-Met to Inhibit Migration, Invasion, and Gefitinib Resistance in Non-Small Cell Lung Cancer. Cytogenet Genome Res. 2015;146(1):1-8. | ||||
REF 14 | XIAP BIR domain suppresses miR-200a expression and subsequently promotes EGFR protein translation and anchorage-independent growth of bladder cancer cell. J Hematol Oncol. 2017 Jan 5;10(1):6. | ||||
REF 15 | Regulation of ErbB receptor signalling in cancer cells by microRNA. Curr Opin Pharmacol. 2010 Dec;10(6):655-61. | ||||
REF 16 | Downregulation of miR-21 inhibits EGFR pathway and suppresses the growth of human glioblastoma cells independent of PTEN status. Lab Invest. 2010 Feb;90(2):144-55. | ||||
REF 17 | Mutant p53-R273H gains new function in sustained activation of EGFR signaling via suppressing miR-27a expression. Cell Death Dis. 2013 Apr 4;4:e574. | ||||
REF 18 | Cross-talk between MET and EGFR in non-small cell lung cancer involves miR-27a and Sprouty2. Proc Natl Acad Sci U S A. 2013 May 21;110(21):8573-8. | ||||
REF 19 | MicroRNA-302b suppresses cell proliferation by targeting EGFR in human hepatocellular carcinoma SMMC-7721 cells. BMC Cancer. 2013 Oct 2;13:448. | ||||
REF 20 | The miR-302/367 cluster: a comprehensive update on its evolution and functions. Open Biol. 2015 Dec;5(12):150138. | ||||
REF 21 | Two mature products of MIR-491 coordinate to suppress key cancer hallmarks in glioblastoma. Oncogene. 2015 Mar 26;34(13):1619-1628. | ||||
REF 22 | Ginsenoside Rh2 Targets EGFR by Up-Regulation of miR-491 to Enhance Anti-tumor Activity in Hepatitis B Virus-Related Hepatocellular Carcinoma. Cell Biochem Biophys. 2015 Jun;72(2):325-31. | ||||
REF 23 | EGFR promotes lung tumorigenesis by activating miR-7 through a Ras/ERK/Myc pathway that targets the Ets2 transcriptional repressor ERF. Cancer Res. 2010 Nov 1;70(21):8822-31. | ||||
REF 24 | microRNA-7 inhibits the epidermal growth factor receptor and the Akt pathway and is down-regulated in glioblastoma. Cancer Res. 2008 May 15;68(10):3566-72. | ||||
REF 25 | Isolation of miRNAs that target EGFR mRNA in human lung cancer. Biochem Biophys Res Commun. 2012 Apr 6;420(2):411-6. | ||||
REF 26 | miR-875-5p counteracts epithelial-to-mesenchymal transition and enhances radiation response in prostate cancer through repression of the EGFR-ZEB1 axis. Cancer Lett. 2017 Jun 1;395:53-62. | ||||
REF 27 | Hsa-miR-875-5p exerts tumor suppressor function through down-regulation of EGFR in colorectal carcinoma (CRC). Oncotarget. 2016 Jul 5;7(27):42225-42240. | ||||
REF 28 | MicroRNA-122a Regulates Zonulin by Targeting EGFR in Intestinal Epithelial Dysfunction. Cell Physiol Biochem. 2017;42(2):848-858. | ||||
REF 29 | MicroRNA-7 as a tumor suppressor and novel therapeutic for adrenocortical carcinoma. Oncotarget. 2015 Nov 3;6(34):36675-88. | ||||
REF 30 | MiR-145 inhibits cell proliferation of human lung adenocarcinoma by targeting EGFR and NUDT1. RNA Biol. 2011 Jan-Feb;8(1):125-31. | ||||
REF 31 | MicroRNA-146b-5p inhibits the growth of gallbladder carcinoma by targeting epidermal growth factor receptor. Mol Med Rep. 2015 Jul;12(1):1549-55. | ||||
REF 32 | MicroRNA-27a functions as a tumor suppressor in renal cell carcinoma by targeting epidermal growth factor receptor. Oncol Lett. 2016 Jun;11(6):4217-4223. | ||||
REF 33 | Dual regulation of receptor tyrosine kinase genes EGFR and c-Met by the tumor-suppressive microRNA-23b/27b cluster in bladder cancer. Int J Oncol. 2015 Feb;46(2):487-96. | ||||
REF 34 | Genistein up-regulates tumor suppressor microRNA-574-3p in prostate cancer. PLoS One. 2013;8(3):e58929. | ||||
REF 35 | miR-2861 acts as a tumor suppressor via targeting EGFR/AKT2/CCND1 pathway in cervical cancer induced by human papillomavirus virus 16 E6. Sci Rep. 2016 Jul 1;6:28968. | ||||
REF 36 | Novel tumor suppressor microRNA at frequently deleted chromosomal region 8p21 regulates epidermal growth factor receptor in prostate cancer. Oncotarget. 2016 Oct 25;7(43):70388-70403. | ||||
REF 37 | miR-7 reverses the resistance to BRAFi in melanoma by targeting EGFR/IGF-1R/CRAF and inhibiting the MAPK and PI3K/AKT signaling pathways. Oncotarget. 2016 Aug 16;7(33):53558-53570. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Wang and Dr. Li.