Target General Information
Target ID T59328 Target Info
Target Name Epidermal growth factor receptor (EGFR)
Synonyms Receptor tyrosine-protein kinase erbB-1; Proto-oncogene c-ErbB-1; HER1; ERBB1; ERBB
Target Type Successful Target
Gene Name EGFR
Biochemical Class Kinase
UniProt ID
The microRNAs (miRNAs) Regulating This Target
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism Reexpression of miR-146a led to the inhibition of EGFR signaling in pancreatic cancer cells. [6]
Evidence Score (E-score) 7 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay; Western Blot [4]
5 qRT-PCR; Western Blot [5]
6 Western Blot [6]
7 Western Blot; qRT-PCR [7]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
Apoptosis mediating surface antigen FAS (FAS) Target Info
miRNA Mature ID hsa-miR-133b miRNA Info
miRNA Mature AC
Sequence uuugguccccuucaaccagcua
miRNA Species Homo sapiens
Regulation Mechanism EGFR was significantly lowered after transfection of miR-133b. [10]
Evidence Score (E-score) 3 +
1 In Situ Hybridization; Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
2 Luciferase Reporter Assay; Western Blot [9]
3 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
Apoptosis regulator Bcl-W (BCL-W) Target Info
miRNA Mature ID hsa-miR-125a-5p miRNA Info
miRNA Mature AC
Sequence ucccugagacccuuuaaccuguga
miRNA Species Homo sapiens
Regulation Mechanism miR-125a regulates cell cycle, proliferation, and apoptosis by targeting the ErbB pathway in acute myeloid leukemia. [11]
Evidence Score (E-score) 2 +
1 qRT-PCR; Western Blot [11]
2 Western Blot; RT-PCR [12]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
Apoptosis regulator Bcl-2 (BCL-2) Target Info
miRNA Mature ID hsa-miR-200a-3p miRNA Info
miRNA Mature AC
Sequence uaacacugucugguaacgaugu
miRNA Species Homo sapiens
Regulation Mechanism Wild-type (WT) and mutated (Mut) of EGFR 3'UTR Luciferase reporters were stably co-transfected with miR-200a or its scramble vector, and the stable transfectants were used to evaluate for their reporter activity. [14]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; RT-PCR; Western Blot [13]
2 Western Blot [14]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
Beta-catenin (CTNNB1) Target Info
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Microarray; Western Blot [15]
2 Western Blot [16]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
Apoptosis regulator Bcl-2 (BCL-2) Target Info
miRNA Mature ID hsa-miR-27a-3p miRNA Info
miRNA Mature AC
Sequence uucacaguggcuaaguuccgc
miRNA Species Homo sapiens
Regulation Mechanism miR-27a is targeted to the region 1 of EGFR 3-UTR. [17]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [17]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [18]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
Cellular tumor antigen p53 (TP53) Target Info
miRNA Mature ID hsa-miR-302b-3p miRNA Info
miRNA Mature AC
Sequence uaagugcuuccauguuuuaguag
miRNA Species Homo sapiens
Regulation Mechanism Re-expression of miR-302b did not affect the mRNA expression of EGFR, but could suppress EGFR at the protein level. [19]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [19]
2 Western Blot [20]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
Dihydrothymine dehydrogenase (DPYD) Target Info
miRNA Mature ID hsa-miR-491-5p miRNA Info
miRNA Mature AC
Sequence aguggggaacccuuccaugagg
miRNA Species Homo sapiens
Regulation Mechanism miR-491-5p regulates EGFR by directly targeting its 3'UTR. [21]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [21]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [22]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
Cellular tumor antigen p53 (TP53) Target Info
miRNA Mature ID hsa-miR-7-5p miRNA Info
miRNA Mature AC
Sequence uggaagacuagugauuuuguugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-7-5p by mature miRNA precursor transfection resulted in the decreased protein level of target EGFR. [24]
Evidence Score (E-score) 2 +
1 Western Blot; qRT-PCR [23]
2 Western Blot; qRT-PCR; Luciferase Reporter Assay [24]
Representative Target(s) Regulated by This miRNA Activated CDC42 kinase 1 (ACK-1) Target Info
Epidermal growth factor receptor (EGFR) Target Info
miRNA Mature ID hsa-miR-542-5p miRNA Info
miRNA Mature AC
Sequence ucggggaucaucaugucacgaga
miRNA Species Homo sapiens
Regulation Mechanism miR-542-5p directly targets EGFR in lung cancer cell lines. [25]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [25]
2 Western Blot; RT-PCR; Immunohistochemistry [25]
Representative Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Target Info
miRNA Mature ID hsa-miR-875-5p miRNA Info
miRNA Mature AC
Sequence uauaccucaguuuuaucaggug
miRNA Species Homo sapiens
Regulation Mechanism Oncogene EGFR was revealed to be a target of miR-875-5p, which was inversely correlated with miR-875-5p expression in CRC. [27]
Evidence Score (E-score) 2 +
1 Immunofluorescence; Luciferase Reporter Assay; qRT-PCR; Western Blot [26]
2 Luciferase Reporter Assay; Western Blot [27]
Representative Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Target Info
miRNA Mature ID hsa-miR-122-5p miRNA Info
miRNA Mature AC
Sequence uggagugugacaaugguguuug
miRNA Species Homo sapiens
Regulation Mechanism The miR-122a significantly decreased the relative luciferase activity in the WT 3'TR of EGFR. [28]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [28]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-W (BCL-W) Target Info
Apoptosis regulator Bcl-xL (BCL-xL) Target Info
miRNA Mature ID hsa-miR-132-3p miRNA Info
miRNA Mature AC
Sequence uaacagucuacagccauggucg
miRNA Species Homo sapiens
Regulation Mechanism miR-7 can regulates EGFR gene by binding to the 3'UTR. [29]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [29]
Representative Target(s) Regulated by This miRNA Brain-derived neurotrophic factor (BDNF) Target Info
Cyclin A2 (CCNA2) Target Info
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism hsa-miR-145 either directly or indirectly suppresses EGFR transcript levels. [30]
Evidence Score (E-score) 1 +
1 Western Blot [30]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
Alkaline phosphatase (ALPPL2) Target Info
miRNA Mature ID hsa-miR-146b-5p miRNA Info
miRNA Mature AC
Sequence ugagaacugaauuccauaggcug
miRNA Species Homo sapiens
Regulation Mechanism The activity of a luciferase reporter gene linked to the wild-type EGFR 3'UTR fragment decreased in response to transfection with miR-146-5p mimics. [31]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [31]
Representative Target(s) Regulated by This miRNA Calgranulin D (S100A12) Target Info
DNA-binding factor KBF1 (p105) Target Info
miRNA Mature ID hsa-miR-27a-5p miRNA Info
miRNA Mature AC
Sequence agggcuuagcugcuugugagca
miRNA Species Homo sapiens
Regulation Mechanism Epidermal growth factor receptor (EGFR) was a target gene of miR-27a. [32]
Evidence Score (E-score) 1 +
1 Western Blot [32]
Representative Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Target Info
Gremlin-1 (Gremlin-1) Target Info
miRNA Mature ID hsa-miR-27b-3p miRNA Info
miRNA Mature AC
Sequence uucacaguggcuaaguucugc
miRNA Species Homo sapiens
Regulation Mechanism EGFR was significantly reduced by transfection of miR-27b with the wild-type vector carrying the 3'UTR of EGFR. [33]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [33]
Representative Target(s) Regulated by This miRNA Adenosine A2b receptor (ADORA2B) Target Info
Albendazole monooxygenase (CYP3A4) Target Info
miRNA Mature ID hsa-miR-574-3p miRNA Info
miRNA Mature AC
Sequence cacgcucaugcacacacccaca
miRNA Species Homo sapiens
Regulation Mechanism miR-574-3p decreased the relative luciferase activities of EGFR. [34]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [34]
Representative Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Target Info
Histone acetyltransferase p300 (EP300) Target Info
miRNA Mature ID hsa-miR-2861 miRNA Info
miRNA Mature AC
Sequence ggggccuggcggugggcgg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [35]
Representative Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Target Info
G1/S-specific cyclin-D1 (CCND1) Target Info
miRNA Mature ID hsa-miR-3622b-5p miRNA Info
miRNA Mature AC
Sequence aggcaugggaggucagguga
miRNA Species Homo sapiens
Regulation Mechanism miR-3622b directly represses Epidermal Growth Factor Receptor (EGFR). [36]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [36]
Representative Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Target Info
Erbb2 tyrosine kinase receptor (HER2) Target Info
miRNA Mature ID hsa-miR-7-1-3p miRNA Info
miRNA Mature AC
Sequence caacaaaucacagucugccaua
miRNA Species Homo sapiens
Regulation Mechanism Introduction of miR-7 mimics could markedly decrease the expressions of EGFR. [37]
Evidence Score (E-score) 1 +
1 Western Blot [37]
Representative Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Target Info
Insulin-like growth factor I receptor (IGF1R) Target Info
References
REF 1 Down-regulation of microRNA-146a is associated with high-risk human papillomavirus infection and epidermal growth factor receptor overexpression in penile squamous cell carcinoma. Hum Pathol. 2017 Mar;61:33-40.
REF 2 Deregulation of miR-146a expression in a mouse model of pancreatic cancer affecting EGFR signaling. Cancer Lett. 2014 Aug 28;351(1):134-42.
REF 3 MiR-146a suppresses tumor growth and progression by targeting EGFR pathway and in a p-ERK-dependent manner in castration-resistant prostate cancer. Prostate. 2012 Aug 1;72(11):1171-8.
REF 4 Clinical significance of miR-146a in gastric cancer cases. Clin Cancer Res. 2011 Jul 1;17(13):4277-84.
REF 5 miR-146a suppresses invasion of pancreatic cancer cells. Cancer Res. 2010 Feb 15;70(4):1486-95.
REF 6 Breast cancer metastasis suppressor 1 up-regulates miR-146, which suppresses breast cancer metastasis. Cancer Res. 2009 Feb 15;69(4):1279-83.
REF 7 miR-146a inhibits cell growth, cell migration and induces apoptosis in non-small cell lung cancer cells. PLoS One. 2013;8(3):e60317.
REF 8 MicroRNA-133b inhibits the growth of non-small-cell lung cancer by targeting the epidermal growth factor receptor. FEBS J. 2012 Oct;279(20):3800-12.
REF 9 MicroRNA-133b inhibits proliferation and invasion of ovarian cancer cells through Akt and Erk1/2 inactivation by targeting epidermal growth factor ... Int J Clin Exp Pathol. 2015 Sep 1;8(9):10605-14.
REF 10 microRNA-133 inhibits cell proliferation, migration and invasion in prostate cancer cells by targeting the epidermal growth factor receptor. Oncol Rep. 2012 Jun;27(6):1967-75.
REF 11 miR-125a regulates cell cycle, proliferation, and apoptosis by targeting the ErbB pathway in acute myeloid leukemia. Leuk Res. 2014 Mar;38(3):402-10.
REF 12 Epidermal growth factor receptor-regulated miR-125a-5p--a metastatic inhibitor of lung cancer. FEBS J. 2009 Oct;276(19):5571-8.
REF 13 MicroRNA-200a Targets EGFR and c-Met to Inhibit Migration, Invasion, and Gefitinib Resistance in Non-Small Cell Lung Cancer. Cytogenet Genome Res. 2015;146(1):1-8.
REF 14 XIAP BIR domain suppresses miR-200a expression and subsequently promotes EGFR protein translation and anchorage-independent growth of bladder cancer cell. J Hematol Oncol. 2017 Jan 5;10(1):6.
REF 15 Regulation of ErbB receptor signalling in cancer cells by microRNA. Curr Opin Pharmacol. 2010 Dec;10(6):655-61.
REF 16 Downregulation of miR-21 inhibits EGFR pathway and suppresses the growth of human glioblastoma cells independent of PTEN status. Lab Invest. 2010 Feb;90(2):144-55.
REF 17 Mutant p53-R273H gains new function in sustained activation of EGFR signaling via suppressing miR-27a expression. Cell Death Dis. 2013 Apr 4;4:e574.
REF 18 Cross-talk between MET and EGFR in non-small cell lung cancer involves miR-27a and Sprouty2. Proc Natl Acad Sci U S A. 2013 May 21;110(21):8573-8.
REF 19 MicroRNA-302b suppresses cell proliferation by targeting EGFR in human hepatocellular carcinoma SMMC-7721 cells. BMC Cancer. 2013 Oct 2;13:448.
REF 20 The miR-302/367 cluster: a comprehensive update on its evolution and functions. Open Biol. 2015 Dec;5(12):150138.
REF 21 Two mature products of MIR-491 coordinate to suppress key cancer hallmarks in glioblastoma. Oncogene. 2015 Mar 26;34(13):1619-1628.
REF 22 Ginsenoside Rh2 Targets EGFR by Up-Regulation of miR-491 to Enhance Anti-tumor Activity in Hepatitis B Virus-Related Hepatocellular Carcinoma. Cell Biochem Biophys. 2015 Jun;72(2):325-31.
REF 23 EGFR promotes lung tumorigenesis by activating miR-7 through a Ras/ERK/Myc pathway that targets the Ets2 transcriptional repressor ERF. Cancer Res. 2010 Nov 1;70(21):8822-31.
REF 24 microRNA-7 inhibits the epidermal growth factor receptor and the Akt pathway and is down-regulated in glioblastoma. Cancer Res. 2008 May 15;68(10):3566-72.
REF 25 Isolation of miRNAs that target EGFR mRNA in human lung cancer. Biochem Biophys Res Commun. 2012 Apr 6;420(2):411-6.
REF 26 miR-875-5p counteracts epithelial-to-mesenchymal transition and enhances radiation response in prostate cancer through repression of the EGFR-ZEB1 axis. Cancer Lett. 2017 Jun 1;395:53-62.
REF 27 Hsa-miR-875-5p exerts tumor suppressor function through down-regulation of EGFR in colorectal carcinoma (CRC). Oncotarget. 2016 Jul 5;7(27):42225-42240.
REF 28 MicroRNA-122a Regulates Zonulin by Targeting EGFR in Intestinal Epithelial Dysfunction. Cell Physiol Biochem. 2017;42(2):848-858.
REF 29 MicroRNA-7 as a tumor suppressor and novel therapeutic for adrenocortical carcinoma. Oncotarget. 2015 Nov 3;6(34):36675-88.
REF 30 MiR-145 inhibits cell proliferation of human lung adenocarcinoma by targeting EGFR and NUDT1. RNA Biol. 2011 Jan-Feb;8(1):125-31.
REF 31 MicroRNA-146b-5p inhibits the growth of gallbladder carcinoma by targeting epidermal growth factor receptor. Mol Med Rep. 2015 Jul;12(1):1549-55.
REF 32 MicroRNA-27a functions as a tumor suppressor in renal cell carcinoma by targeting epidermal growth factor receptor. Oncol Lett. 2016 Jun;11(6):4217-4223.
REF 33 Dual regulation of receptor tyrosine kinase genes EGFR and c-Met by the tumor-suppressive microRNA-23b/27b cluster in bladder cancer. Int J Oncol. 2015 Feb;46(2):487-96.
REF 34 Genistein up-regulates tumor suppressor microRNA-574-3p in prostate cancer. PLoS One. 2013;8(3):e58929.
REF 35 miR-2861 acts as a tumor suppressor via targeting EGFR/AKT2/CCND1 pathway in cervical cancer induced by human papillomavirus virus 16 E6. Sci Rep. 2016 Jul 1;6:28968.
REF 36 Novel tumor suppressor microRNA at frequently deleted chromosomal region 8p21 regulates epidermal growth factor receptor in prostate cancer. Oncotarget. 2016 Oct 25;7(43):70388-70403.
REF 37 miR-7 reverses the resistance to BRAFi in melanoma by targeting EGFR/IGF-1R/CRAF and inhibiting the MAPK and PI3K/AKT signaling pathways. Oncotarget. 2016 Aug 16;7(33):53558-53570.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Wang and Dr. Li.