Target Regulator(s) Information (MicroRNA)
Target General Information | |||||
---|---|---|---|---|---|
Target ID | T74312 | Target Info | |||
Target Name | Fms-like tyrosine kinase 3 (FLT-3) | ||||
Synonyms | Stem cell tyrosine kinase 1; STK1; STK-1; Receptor-type tyrosine-protein kinase FLT3; Fetal liver kinase-2; FLT-3; FLK2; FLK-2; FL cytokine receptor; CD135 | ||||
Target Type | Successful Target | ||||
Gene Name | FLT3 | ||||
Biochemical Class | Kinase | ||||
UniProt ID | |||||
The microRNAs (miRNAs) Regulating This Target | |||||
miRNA Mature ID | hsa-miR-150-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | ucucccaacccuuguaccagug | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-150 targeted the 3'UTR of FLT3 directly. | [1] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay | [1] | |||
2 | qPCR | [2] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis inhibitor survivin (BIRC5) | Target Info | |||
Beta-arrestin-2 (ARRB2) | Target Info | ||||
References | |||||
REF 1 | Blockade of miR-150 maturation by MLL-fusion/MYC/LIN-28 is required for MLL-associated leukemia. Cancer Cell. 2012 Oct 16;22(4):524-35. | ||||
REF 2 | MYSM1/miR-150/FLT3 inhibits B1a cell proliferation. Oncotarget. 2016 Oct 18;7(42):68086-68096. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Wang and Dr. Li.