Target General Information
Target ID T74312 Target Info
Target Name Fms-like tyrosine kinase 3 (FLT-3)
Synonyms Stem cell tyrosine kinase 1; STK1; STK-1; Receptor-type tyrosine-protein kinase FLT3; Fetal liver kinase-2; FLT-3; FLK2; FLK-2; FL cytokine receptor; CD135
Target Type Successful Target
Gene Name FLT3
Biochemical Class Kinase
UniProt ID
The microRNAs (miRNAs) Regulating This Target
miRNA Mature ID hsa-miR-150-5p miRNA Info
miRNA Mature AC
Sequence ucucccaacccuuguaccagug
miRNA Species Homo sapiens
Regulation Mechanism miR-150 targeted the 3'UTR of FLT3 directly. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 qPCR [2]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
Beta-arrestin-2 (ARRB2) Target Info
References
REF 1 Blockade of miR-150 maturation by MLL-fusion/MYC/LIN-28 is required for MLL-associated leukemia. Cancer Cell. 2012 Oct 16;22(4):524-35.
REF 2 MYSM1/miR-150/FLT3 inhibits B1a cell proliferation. Oncotarget. 2016 Oct 18;7(42):68086-68096.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Wang and Dr. Li.