Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T74312 |
Target Info
|
| Target Name |
Fms-like tyrosine kinase 3 (FLT-3) |
| Synonyms |
Stem cell tyrosine kinase 1; STK1; STK-1; Receptor-type tyrosine-protein kinase FLT3; Fetal liver kinase-2; FLT-3; FLK2; FLK-2; FL cytokine receptor; CD135 |
| Target Type |
Successful Target |
| Gene Name |
FLT3 |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-150-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ucucccaacccuuguaccagug
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-150 targeted the 3'UTR of FLT3 directly. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
qPCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
|
Beta-arrestin-2 (ARRB2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Blockade of miR-150 maturation by MLL-fusion/MYC/LIN-28 is required for MLL-associated leukemia. Cancer Cell. 2012 Oct 16;22(4):524-35.
|
| REF 2 |
MYSM1/miR-150/FLT3 inhibits B1a cell proliferation. Oncotarget. 2016 Oct 18;7(42):68086-68096.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
